ID: 1110416582

View in Genome Browser
Species Human (GRCh38)
Location 13:75260089-75260111
Sequence GTGGAGGGAGGGCATGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110416582_1110416593 5 Left 1110416582 13:75260089-75260111 CCTTTCACATGCCCTCCCTCCAC No data
Right 1110416593 13:75260117-75260139 CCACCCCCACACACATCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110416582 Original CRISPR GTGGAGGGAGGGCATGTGAA AGG (reversed) Intergenic
No off target data available for this crispr