ID: 1110418614

View in Genome Browser
Species Human (GRCh38)
Location 13:75279358-75279380
Sequence CTGCAGGGATTGGGGAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110418605_1110418614 14 Left 1110418605 13:75279321-75279343 CCACTGGAGCAAGAGCATGAATA No data
Right 1110418614 13:75279358-75279380 CTGCAGGGATTGGGGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110418614 Original CRISPR CTGCAGGGATTGGGGAAAAG GGG Intergenic
No off target data available for this crispr