ID: 1110419740

View in Genome Browser
Species Human (GRCh38)
Location 13:75292875-75292897
Sequence CAGATGTGAGCCAACACGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156520
Summary {0: 3, 1: 377, 2: 7126, 3: 38537, 4: 110477}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110419740_1110419742 -5 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419742 13:75292893-75292915 ATCTGTAAACCCAACAATTTGGG 0: 1
1: 18
2: 924
3: 16685
4: 134562
1110419740_1110419750 15 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419750 13:75292913-75292935 GGGAGGCTGAGGTGGGTGGATGG 0: 63
1: 1348
2: 4028
3: 8276
4: 72399
1110419740_1110419748 8 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419748 13:75292906-75292928 ACAATTTGGGAGGCTGAGGTGGG 0: 78
1: 3808
2: 50207
3: 184281
4: 373479
1110419740_1110419745 4 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419745 13:75292902-75292924 CCCAACAATTTGGGAGGCTGAGG 0: 144
1: 8872
2: 116823
3: 338077
4: 450569
1110419740_1110419743 -2 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419743 13:75292896-75292918 TGTAAACCCAACAATTTGGGAGG 0: 3
1: 572
2: 28991
3: 347622
4: 322239
1110419740_1110419749 11 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419749 13:75292909-75292931 ATTTGGGAGGCTGAGGTGGGTGG 0: 1022
1: 36462
2: 102887
3: 195087
4: 199501
1110419740_1110419752 27 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419752 13:75292925-75292947 TGGGTGGATGGCTTGAGGCTAGG 0: 4
1: 70
2: 1929
3: 15649
4: 57312
1110419740_1110419747 7 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419747 13:75292905-75292927 AACAATTTGGGAGGCTGAGGTGG 0: 108
1: 6047
2: 79509
3: 180543
4: 188546
1110419740_1110419741 -6 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419741 13:75292892-75292914 CATCTGTAAACCCAACAATTTGG 0: 1
1: 18
2: 840
3: 15219
4: 116764
1110419740_1110419751 22 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419751 13:75292920-75292942 TGAGGTGGGTGGATGGCTTGAGG 0: 13
1: 427
2: 5589
3: 22539
4: 53651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110419740 Original CRISPR CAGATGTGAGCCAACACGCC CGG (reversed) Intronic
Too many off-targets to display for this crispr