ID: 1110419742

View in Genome Browser
Species Human (GRCh38)
Location 13:75292893-75292915
Sequence ATCTGTAAACCCAACAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152190
Summary {0: 1, 1: 18, 2: 924, 3: 16685, 4: 134562}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110419740_1110419742 -5 Left 1110419740 13:75292875-75292897 CCGGGCGTGTTGGCTCACATCTG 0: 3
1: 377
2: 7126
3: 38537
4: 110477
Right 1110419742 13:75292893-75292915 ATCTGTAAACCCAACAATTTGGG 0: 1
1: 18
2: 924
3: 16685
4: 134562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110419742 Original CRISPR ATCTGTAAACCCAACAATTT GGG Intronic
Too many off-targets to display for this crispr