ID: 1110421184

View in Genome Browser
Species Human (GRCh38)
Location 13:75310811-75310833
Sequence AGACACCGGGACCCCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1136
Summary {0: 1, 1: 0, 2: 20, 3: 183, 4: 932}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110421184 Original CRISPR AGACACCGGGACCCCCTTGA GGG (reversed) Intronic
900508665 1:3044905-3044927 AGACACCAGGGCCTACTTGAAGG - Intergenic
900825753 1:4925355-4925377 AGACACTGGGGCCTGCTTGAGGG - Intergenic
901395806 1:8980596-8980618 AGACACTGGGGCCATCTTGAAGG + Intergenic
903372178 1:22843505-22843527 AGACACTGGGGCCTACTTGAGGG - Intronic
903988503 1:27247487-27247509 AGACACTGGAACCTACTTGAGGG - Intronic
904147462 1:28404921-28404943 AGACACTGGGGCCTGCTTGAGGG - Intronic
904233005 1:29092711-29092733 AGACACCAGGGCCTACTTGAGGG - Intronic
904627748 1:31816488-31816510 AGACACTGGGGCCTGCTTGAGGG - Intergenic
904640870 1:31927334-31927356 AGACACTGGGGACCACTTGAGGG + Intronic
905465834 1:38152465-38152487 TGACACTGGGAACTCCTTGAGGG + Intergenic
906292087 1:44625954-44625976 AGACTCTGGGATCCCCATGAAGG - Intronic
906836783 1:49092012-49092034 AGACACTGGGGCCTACTTGAGGG + Intronic
906882709 1:49609751-49609773 AGACACCAGGGCCTACTTGAGGG - Intronic
906906803 1:49903333-49903355 AGACACCAGAGCCCACTTGAGGG + Intronic
907577057 1:55536081-55536103 AGACACTGGGGCCCACCTGAGGG + Intergenic
908862994 1:68511224-68511246 AGACACTGGGGCCTACTTGAGGG + Intergenic
908998786 1:70192793-70192815 AGACACTGGGGTCCTCTTGAGGG + Intronic
909224350 1:72997894-72997916 AGACAGCTGGGCCTCCTTGATGG - Intergenic
909399602 1:75212352-75212374 AGACACTGGGACCTACTTGAGGG - Intronic
909714844 1:78695168-78695190 AGACACCAGGGCCTCCCTGAGGG - Intergenic
909972839 1:82010653-82010675 AGACACCGGGGCCTACTTGAGGG - Intergenic
910139747 1:84014053-84014075 AGACACCGGGGCCTACTTGAGGG + Intergenic
910166356 1:84331896-84331918 AGACACTGGGGCCTACTTGAGGG - Intronic
910339891 1:86174003-86174025 AGACACTGGGACCTACCTGAGGG - Intergenic
910592247 1:88938544-88938566 AGACACTGGGGCCTCCTTGAGGG - Intronic
910606010 1:89085595-89085617 AGACACCAGGGCCTTCTTGAGGG + Intergenic
910610892 1:89141026-89141048 AGACACCAGGACCTACTTGAGGG + Intronic
910731632 1:90403977-90403999 AGACACTGGGGCCTACTTGAGGG - Intergenic
911069333 1:93819927-93819949 AGACCCTGGGACCTACTTGAGGG - Intronic
911478938 1:98411901-98411923 AGACACTGGGGCCTACTTGAGGG - Intergenic
911491868 1:98579246-98579268 AGACACCAGCACCTACTTGAGGG - Intergenic
913356149 1:117924292-117924314 AGACACTAGGACCTACTTGAGGG - Intronic
914329325 1:146651323-146651345 AGACACTGGGGCCTACTTGAGGG - Intergenic
914693745 1:150055865-150055887 AGACACTGGGGCCCACTTGAGGG + Intergenic
915784160 1:158589326-158589348 AGACACCAGGGCCTACTTGAGGG + Intergenic
916017861 1:160766082-160766104 AGACACTGGGGCCTACTTGAGGG - Intergenic
916295713 1:163217065-163217087 AGACACAGGGGCCTACTTGAAGG + Intronic
916373864 1:164130100-164130122 AGACACTGGGGCCTACTTGAGGG + Intergenic
916448852 1:164899904-164899926 AGGCACTGGGACCTCCTTGAGGG + Intergenic
916457426 1:164985290-164985312 AGACACCAGGGCCTACTTGAGGG - Intergenic
916593719 1:166221027-166221049 AGACACCAGGGCCTACTTGAAGG - Intergenic
916599053 1:166274928-166274950 AGACACTGGGGCCTACTTGAGGG - Intergenic
917142891 1:171855042-171855064 AGACACTGGGGCCTCCTTGAGGG - Intronic
917261733 1:173176953-173176975 AGACACTGGGGCCTACTTGAGGG + Intergenic
917261778 1:173177424-173177446 AGACACCGGGGCCTACTTGAGGG + Intergenic
917302493 1:173591039-173591061 AGACACTGGGGCCTACTTGAGGG - Intronic
917585222 1:176419284-176419306 AGACACGGGGGCCTACTTGAGGG - Intergenic
918735759 1:188061038-188061060 AGACACTGGGGCCTACTTGAGGG - Intergenic
918803986 1:189015613-189015635 AGGCACTGGGGCCCACTTGAGGG - Intergenic
918858712 1:189793735-189793757 AGACACCAGGGCCTACTTGAGGG - Intergenic
918946146 1:191068090-191068112 AGACACTGGGACCTACTGGAGGG + Intergenic
918981735 1:191570358-191570380 AGACACCAGGACCTACTTGAGGG + Intergenic
919111116 1:193219713-193219735 AGACACCAGGGCCTACTTGAGGG + Intronic
919195390 1:194278513-194278535 AGACACCAGGCCCTTCTTGAAGG + Intergenic
919617512 1:199825949-199825971 AGACACTGGGAACTACTTGAGGG + Intergenic
919902462 1:202054454-202054476 AGACACCGGGGCCTCCTTGAGGG + Intergenic
920687954 1:208124199-208124221 AGACACTGGGGCCTACTTGAGGG + Intronic
921336199 1:214089008-214089030 AGACACTGGGATCTGCTTGAGGG - Intergenic
921390632 1:214609747-214609769 AGACACTGAGGCCTCCTTGAGGG - Intronic
921753682 1:218827190-218827212 AGACACGGGGCCCTACTTGAGGG - Intergenic
921793288 1:219313987-219314009 AGACACTGGGGCCCACTTGAGGG - Intergenic
921840971 1:219827848-219827870 AGATACTGGGGCCCACTTGAGGG - Intronic
921964667 1:221075734-221075756 AGACACTGGGGCCCACTTGAGGG - Intergenic
922386902 1:225095480-225095502 AGACACCGGGGCGTACTTGAAGG + Intronic
923625485 1:235610613-235610635 AGACACAGGAACCAGCTTGAAGG - Intronic
924686702 1:246299816-246299838 AGACACTGGGGCGCACTTGAAGG + Intronic
924702318 1:246466507-246466529 AGACACTGGGGCCTCCTTGAGGG + Intronic
924874799 1:248090448-248090470 AGACACCGGGGCCTACTTGAGGG - Intronic
924891084 1:248280764-248280786 AGACACCGGGGCCTACTTGAGGG - Intergenic
1062902169 10:1154729-1154751 AGCCTCCGGGACCCCCTTGGAGG + Intergenic
1063448031 10:6132444-6132466 AGATACCGGGGCCTCCTTGAGGG + Intergenic
1063699988 10:8375000-8375022 AGACACTGGGTCCTACTTGAGGG - Intergenic
1063836304 10:10017884-10017906 AGACACCGCGGCCTACTTGAAGG - Intergenic
1064104159 10:12487179-12487201 TGACACCGGGGCCTCCTTCAGGG - Intronic
1064621311 10:17220391-17220413 AGACACTGGGGCCTACTTGAGGG + Intergenic
1064818940 10:19301694-19301716 AGTCACCGGGACCTTCTTGAGGG + Intronic
1064844027 10:19631153-19631175 AGACACTGGGGCCTACTTGAAGG - Intronic
1065201766 10:23319165-23319187 AGACACAGGGGCCTACTTGAGGG - Intronic
1065404204 10:25345214-25345236 AGACAAAGGGACCCTCTTGCTGG + Intronic
1065406640 10:25373268-25373290 AGACACTGGGGCCCACTGGAAGG + Intronic
1065445840 10:25797630-25797652 AGACACAGGGGCCTACTTGAGGG - Intergenic
1065602065 10:27379073-27379095 AGACACCGGGGCCTACTTGAGGG - Intergenic
1066162454 10:32748193-32748215 AGACACTGGGGCCTACTTGAGGG + Intronic
1066492307 10:35905638-35905660 AGACACTGGGACCTCCTTAAGGG - Intergenic
1066594498 10:37035177-37035199 AAACACCAGGGCCCCCTTAAGGG + Intergenic
1067157975 10:43798839-43798861 GGACACTGGGTCCCCCATGATGG + Intergenic
1067915355 10:50392013-50392035 AGACACCAGGGCCTACTTGAGGG + Intronic
1068370253 10:56103823-56103845 AGACACCGGGGTCTCCTGGAGGG - Intergenic
1068402491 10:56548522-56548544 AGACACTGGGGCCCACTTGAGGG - Intergenic
1068702768 10:60037454-60037476 AGACACTGGGATCTACTTGAGGG - Intronic
1068708466 10:60104059-60104081 AGACACTGGGGCCTACTTGAAGG + Intronic
1068832610 10:61514548-61514570 AGACACTGGGGCCTACTTGAGGG - Intergenic
1069101798 10:64331499-64331521 AGACACTGGGCTCTCCTTGAGGG - Intergenic
1069934161 10:71903756-71903778 AGACACCGGGGCCTGCTAGAGGG - Intergenic
1069942934 10:71967334-71967356 AGACACCAGGACCTACTTGAGGG - Intronic
1069964371 10:72101967-72101989 AGACACTGGGGCCTCCTTGAGGG + Intronic
1070517865 10:77224955-77224977 TGAGACCAGGAGCCCCTTGAAGG + Intronic
1071770161 10:88720350-88720372 AGACACTGGGGCCTACTTGAGGG + Intergenic
1071772963 10:88750631-88750653 AGACACTGGGGCCTACTTGAGGG + Intronic
1071825906 10:89325688-89325710 AGACACTGGGGCCTACTTGAGGG + Intronic
1072076444 10:91978987-91979009 AGACACTGGGGCCTACTTGAGGG - Intronic
1072430078 10:95363207-95363229 TTACACCTGGAACCCCTTGAGGG + Intronic
1073485658 10:103817316-103817338 AGACACTGGGGCCTACTTGAGGG - Intronic
1073814011 10:107185728-107185750 AAACACTGAGGCCCCCTTGAGGG + Intergenic
1074001084 10:109373566-109373588 AGACACTGGGGCCTACTTGAGGG + Intergenic
1074034264 10:109722377-109722399 AGACACTGGGACCTACTTGCAGG - Intergenic
1076609933 10:131718174-131718196 AGACACTGGGGCCTACTTGAGGG + Intergenic
1076713341 10:132351038-132351060 AGATACTGGGTCCCCCTTGAGGG - Intronic
1076942898 10:133621764-133621786 AGACACTGGGGCCTACTTGAGGG + Intergenic
1077113718 11:873330-873352 GGTAACTGGGACCCCCTTGAGGG + Intronic
1078138259 11:8670354-8670376 AGATACTGGGACCTGCTTGAGGG - Intronic
1078302574 11:10147547-10147569 AGACACTGGGACCTACTTAAGGG + Intronic
1078946861 11:16077788-16077810 AGACACTGGGGCCTACTTGAAGG + Intronic
1079434438 11:20433215-20433237 AGACACTGGGGCCTACTTGAGGG - Intronic
1079680270 11:23287747-23287769 AGACACTGGGGCCTACTTGAGGG + Intergenic
1079744645 11:24109163-24109185 AGACACCGGGAACTACTAGACGG + Intergenic
1080018680 11:27535252-27535274 AGACACTGGGGCCTACTTGAGGG - Intergenic
1080094109 11:28383969-28383991 AGACACTGGGGCCTACTTGAGGG - Intergenic
1080398637 11:31913538-31913560 AGACACTGGGATACCCTTGAGGG - Intronic
1081452981 11:43191126-43191148 AGACACTGGGGCCTACTTGAGGG - Intergenic
1081530061 11:43952233-43952255 AGACACAGGAACCTACTTGAAGG - Intergenic
1082700542 11:56424401-56424423 AGACCCTGGGACCTCCTTGAAGG + Intergenic
1082701546 11:56438016-56438038 AGACACTGGGGTCCACTTGAGGG - Intergenic
1082716218 11:56617421-56617443 AGGCACCAGGACCTACTTGAGGG - Intergenic
1082795219 11:57374091-57374113 AGACACTGGGGTCTCCTTGAGGG + Intergenic
1082873564 11:57965982-57966004 AGACACTGGGGCCTCCTTGATGG - Intergenic
1082921308 11:58497687-58497709 AGACACCAGGGCCTACTTGAGGG + Intergenic
1083677773 11:64336563-64336585 AGACACTGGGGCCTACTTGAGGG - Intergenic
1083770828 11:64866358-64866380 AGACACCAGGGCCTACTTGAGGG + Intronic
1084416169 11:69034047-69034069 AGGCACCTGGTCCCCCTGGAGGG + Intergenic
1084926437 11:72516744-72516766 AGACACTGGGGCCTACTTGAGGG + Intergenic
1084969510 11:72763021-72763043 GGACACCGGAACCAGCTTGAAGG + Intronic
1084984168 11:72852971-72852993 AGACACTGGGGCCTACTTGAAGG + Intronic
1085141289 11:74144612-74144634 AGACACTGGGACCTACTTGAAGG - Intronic
1085246553 11:75106666-75106688 AGACACCAGAGCCCACTTGAGGG + Intronic
1085787589 11:79468744-79468766 AGACACTGGGTCCTACTTGAGGG + Intergenic
1086209882 11:84307327-84307349 AGACACCAGGACTTACTTGAGGG + Intronic
1086526408 11:87732248-87732270 AGACACTGGGGCCTACTTGAGGG - Intergenic
1086592171 11:88527914-88527936 AGACACTGGGGCCTCCATGAGGG + Intronic
1086823958 11:91472014-91472036 AGACACTGGGACCTACTTGAGGG - Intergenic
1086824594 11:91480539-91480561 AGACACTGGGGCCTACTTGAGGG + Intergenic
1087059721 11:93965682-93965704 AGACACTGGGACCCACTCGAGGG - Intergenic
1087362265 11:97176004-97176026 AGACACTGGGGCCTACTTGACGG + Intergenic
1087381828 11:97414447-97414469 AGACACAGGGGCCTACTTGAGGG - Intergenic
1087413830 11:97826591-97826613 AGACACTGGGGCCATCTTGAGGG + Intergenic
1087522474 11:99258305-99258327 AAACACTGGGGCCCACTTGAAGG - Intronic
1087556603 11:99729458-99729480 AGACACTGGGGCCTACTTGAGGG - Intronic
1087614802 11:100475483-100475505 AGACACTGGGGCCTGCTTGAGGG - Intergenic
1087687551 11:101281640-101281662 AGACACTGGGGCCTACTTGAAGG - Intergenic
1087842817 11:102937501-102937523 AGACACTGGGGCCTACTTGAGGG + Intergenic
1087873120 11:103324333-103324355 AGACACCAGGGCCTACTTGAGGG - Intronic
1088338840 11:108740146-108740168 AGACACAGGGGCCTACTTGAGGG - Intronic
1088505922 11:110526790-110526812 AGATACCGGGGCCTACTTGAAGG - Intergenic
1089033184 11:115355446-115355468 AGACACTGGGGCCTACTTGAGGG + Intronic
1089069102 11:115685368-115685390 AGACACTGGAGCCTCCTTGAGGG + Intergenic
1089506962 11:118969872-118969894 AGACACTGGGGCCTACTTGAGGG + Intergenic
1090096629 11:123748382-123748404 AGACACTGGGGCCTACTTGAGGG - Intergenic
1090217070 11:124978014-124978036 AGACACCAGGGCCTACTTGAGGG - Intronic
1091161992 11:133432076-133432098 AGACACCAGGGCCTACTTGAAGG + Intronic
1091729660 12:2871030-2871052 AGACACCAGGGCCTTCTTGAGGG + Intronic
1092274547 12:7049154-7049176 AGACAATGGGGCCCACTTGAGGG - Intronic
1092579815 12:9826852-9826874 AGACACCGGAGCCTACTTGAAGG + Intergenic
1092621743 12:10279154-10279176 AGAAACCAGGACCTGCTTGAGGG - Intergenic
1092889844 12:12958999-12959021 AGGCACTGGGACCTACTTGAGGG - Intergenic
1093030321 12:14282625-14282647 AGACACCAGGACCTACCTGAGGG + Intergenic
1093056147 12:14557665-14557687 AGACACTGGGACCTACTTCAGGG + Intronic
1093218496 12:16390457-16390479 AGACACTGGGGCCTACTTGAGGG - Intronic
1093481645 12:19610098-19610120 AGACACCTGGGCCTACTTGAGGG - Intronic
1093686034 12:22054887-22054909 AGACACTGGGGCCTACTTGAGGG - Intronic
1093787837 12:23213320-23213342 AGACACGGGGGCCTACTTGAGGG - Intergenic
1094079595 12:26518350-26518372 AGACACCAGGTCCTACTTGAGGG + Intronic
1094157661 12:27354399-27354421 AGACATCGGGGCCTACTTGAAGG + Intronic
1094226005 12:28046956-28046978 AGACACTGGGGCCTACTTGAGGG + Intergenic
1094388294 12:29919347-29919369 AGACACTGGGGCCTACTTGAGGG - Intergenic
1095555866 12:43503728-43503750 AGACACCTGGGCCTACTTGAGGG - Intronic
1095571712 12:43690513-43690535 AGACACCGGGACCTACTTGAGGG + Intergenic
1095697658 12:45158980-45159002 AGACACCAGGTCCTACTTGATGG - Intergenic
1095728732 12:45481079-45481101 AGACACTGGGGCCCACTTGAGGG - Intergenic
1095842913 12:46714031-46714053 AGACACTGGGGCCTACTTGAGGG - Intergenic
1095931907 12:47636114-47636136 AAACACAGGGACCTACTTGAGGG + Intergenic
1096346844 12:50856040-50856062 AGACACTGGGGCCTACTTGAGGG + Intronic
1096413698 12:51394669-51394691 AGGCACGGGGGCCCACTTGAGGG + Intronic
1096894259 12:54804471-54804493 AGACACTGGGGCCTACTTGAGGG - Intergenic
1097004557 12:55906568-55906590 AGTCTCAGGGACCCCCTTAAGGG + Intronic
1097129731 12:56803147-56803169 AGACACTGGGGCCTGCTTGAGGG - Intergenic
1097431372 12:59512068-59512090 AGACACCGAGGCCTACTTGAGGG + Intergenic
1097480498 12:60118263-60118285 AGACACTGGGGCCTACTTGAGGG + Intergenic
1097776501 12:63652754-63652776 AGACACTGGGGCCTACTTGAGGG + Intronic
1097950397 12:65420637-65420659 AGACACTGGGGCCTACTTGAGGG - Intronic
1098399747 12:70061905-70061927 AGACACCAGGGCCTACTTGAGGG + Intergenic
1098508531 12:71283560-71283582 AGACACTGGGGCCTACTTGAGGG - Intronic
1098776524 12:74627042-74627064 AGACACTGGGGCCTGCTTGAGGG - Intergenic
1098785261 12:74745309-74745331 AGACACCAGGGCCTGCTTGAGGG - Intergenic
1098945722 12:76587438-76587460 AGACACTGGGGCCTACTTGAGGG - Intergenic
1098989908 12:77054055-77054077 AGACACCAGGGCCTACTTGAGGG + Intronic
1099372037 12:81846105-81846127 AGACACTGGGGCCTTCTTGAGGG - Intergenic
1099395336 12:82131695-82131717 AGACACCAGTACCTACTTGAGGG + Intergenic
1099404180 12:82239681-82239703 AGACACCAGGGCCTACTTGAGGG - Intronic
1099578990 12:84417629-84417651 AGACACTGGGGCCCGCTAGAGGG - Intergenic
1099630907 12:85144074-85144096 AGACACTGGGGCCTACTTGAGGG - Intronic
1099647166 12:85372657-85372679 AGACACCAGGACTTACTTGAGGG - Intergenic
1099827677 12:87799143-87799165 AGACACTGGGGCCTACTTGAGGG - Intergenic
1099843888 12:88004863-88004885 AGACACTGGGTCCAACTTGAGGG + Intronic
1099922806 12:88980187-88980209 AGACACGGGGGCCCACTTGAGGG - Intergenic
1100094525 12:91016029-91016051 AGACACTGGGGCCTACTTGAGGG + Intergenic
1100129094 12:91468241-91468263 AGACACCAGGGCCTACTTGAGGG - Intergenic
1100179879 12:92073665-92073687 AGCCACTGGGACCTACTTGAGGG - Intronic
1100626651 12:96341001-96341023 AGACACCGGGGCCTACTTGAGGG - Intronic
1101067317 12:101035833-101035855 AGACACTGGGGCCTACTTGAGGG + Intronic
1101533675 12:105597694-105597716 AGACACGGGGGTCTCCTTGAGGG + Intergenic
1101806751 12:108070681-108070703 AGACACTGGGATCTACTTGAGGG - Intergenic
1103032973 12:117632698-117632720 AGACACCAGGGCCTACTTGAGGG - Intronic
1103111018 12:118278303-118278325 AGACACCAGGGCCTACTTGAGGG - Intronic
1104330486 12:127839876-127839898 AGACAGTGGGACCTACTTGAGGG + Intergenic
1104537380 12:129630865-129630887 AGACACTGGGGCCTGCTTGAGGG - Intronic
1104853767 12:131892377-131892399 AGACACCAGGTCCCACTTGAGGG + Intergenic
1106520998 13:30497614-30497636 AGACACTGGGGCCTACTTGAGGG - Intronic
1107082810 13:36392866-36392888 AGACACTGGGACCTATTTGAGGG - Intergenic
1107208964 13:37828814-37828836 AGACACTGGGGCCTACTTGATGG + Intronic
1107236582 13:38177748-38177770 AGACACTAGGACCTCCTTGAGGG + Intergenic
1107330308 13:39292633-39292655 AGACACCAGGGCCTACTTGAGGG + Intergenic
1108130433 13:47293539-47293561 AGACCCCAGGACCTACTTGAGGG - Intergenic
1108467875 13:50736333-50736355 AGACACTGGGGCCTACTTGAGGG + Intronic
1108529312 13:51314278-51314300 AGACACCGGGACTTCCTTGAGGG + Intergenic
1109133255 13:58614448-58614470 AGACACTGGGGCTTCCTTGAGGG + Intergenic
1109158292 13:58939349-58939371 AGACACTGGGGCCTACTTGAGGG - Intergenic
1109655457 13:65384999-65385021 AGACACTGGGGCCAACTTGAAGG - Intergenic
1109813809 13:67551898-67551920 AGACACCTGGGCCTCCTTGAGGG + Intergenic
1109833471 13:67825024-67825046 AGACACTGGGATCTACTTGAGGG - Intergenic
1109986149 13:69988124-69988146 AGACACTGGGGCCAACTTGAGGG - Intronic
1110020707 13:70466751-70466773 AGACACCAGGGCCTACTTGAGGG - Intergenic
1110421184 13:75310811-75310833 AGACACCGGGACCCCCTTGAGGG - Intronic
1110610489 13:77482067-77482089 AGACACTGGGGCCTACTTGAGGG - Intergenic
1110829986 13:80019597-80019619 AAACACCGGGGCCTACTTGAGGG + Intergenic
1110875239 13:80501552-80501574 TGACACCAGGACCTACTTGAGGG + Intergenic
1111050031 13:82870822-82870844 AGACACCTGGGCCTACTTGAGGG - Intergenic
1111495026 13:89036263-89036285 AGACACTGGGGCCCATTTGAGGG - Intergenic
1111532789 13:89561468-89561490 AGATACTGGGGCCTCCTTGAGGG + Intergenic
1111638059 13:90931143-90931165 AGACACTGGGGCCTACTTGAGGG + Intergenic
1112227404 13:97553296-97553318 AGACGCTGGGACCTACTTGAGGG - Intergenic
1112351378 13:98637478-98637500 ACACACTGGGTCCTCCTTGAGGG - Intergenic
1112865097 13:103885443-103885465 AGACACCAGGACCTACTTGAGGG + Intergenic
1112912570 13:104506280-104506302 AGACACTGGGGCCTACTTGAGGG + Intergenic
1113178500 13:107596653-107596675 ACACACCGGGGCCCTGTTGAGGG + Intronic
1113247802 13:108417977-108417999 AGACACTGGGACCTACTTGAGGG - Intergenic
1113281571 13:108794156-108794178 AGACACCAGGGCCCACTTAAGGG + Intronic
1113860925 13:113486330-113486352 AGACACCAGGGCCTGCTTGAGGG + Intronic
1114057770 14:18988798-18988820 AGACACTGGGGCCTACTTGAGGG - Intronic
1114104777 14:19412955-19412977 AGACACTGGGGCCTACTTGAGGG + Intronic
1114397116 14:22374296-22374318 AGACACCAGGGCCCAGTTGAGGG - Intergenic
1114760265 14:25306538-25306560 AGACACCGGGGCCTACTTGAGGG + Intergenic
1114763689 14:25346509-25346531 AGACACTGGGGCCTACTTGAGGG - Intergenic
1114902540 14:27082438-27082460 AGACACTGGGGCCTACTTGAGGG - Intergenic
1114972513 14:28050755-28050777 AGACACCAGGGCCTACTTGAAGG - Intergenic
1115283265 14:31688824-31688846 AGACACTGGGGCCTACTTGAGGG - Intronic
1115341900 14:32301428-32301450 AGACACCAGGACCTACCTGAGGG - Intergenic
1115391760 14:32861984-32862006 AGACACCAGGGCCTACTTGAGGG - Intergenic
1116148280 14:41103036-41103058 AGACATTGGGACCTACTTGAAGG - Intergenic
1116316990 14:43410092-43410114 AGACACAGGGACTTGCTTGAGGG - Intergenic
1116558683 14:46347572-46347594 AGACACTGGGGCCTGCTTGAGGG + Intergenic
1116800184 14:49435523-49435545 AGACACTGGGTCCTACTTGAGGG + Intergenic
1117019757 14:51557788-51557810 AGACACCGGGACCTACTTGAAGG + Intronic
1117272046 14:54154645-54154667 AGACACTGGGGCCCACTTGAGGG - Intergenic
1117451829 14:55858623-55858645 AGACACTGGGGCCTACTTGAAGG - Intergenic
1117671834 14:58115889-58115911 AGACACTGGGGCCTACTTGAGGG + Intronic
1117821347 14:59652659-59652681 AGACACTGGGGCCTACTTGAGGG + Intronic
1117838641 14:59833694-59833716 AGACACCAGGGCCTACTTGAGGG - Intronic
1118081206 14:62362761-62362783 AGACACCAGGCCCTACTTGAAGG - Intergenic
1118426452 14:65669010-65669032 AGACACTGGGGCCTACTTGAGGG + Intronic
1118515204 14:66520867-66520889 AGACACTGGGGCCTGCTTGAGGG - Intronic
1118598816 14:67457109-67457131 AGACACCAGGGCCTACTTGAGGG + Intronic
1118665921 14:68069446-68069468 AGACACTGGGACCTACTTAAGGG - Intronic
1118680425 14:68236039-68236061 AGACACCAGGGCCTACTTGAGGG + Intronic
1118877887 14:69799782-69799804 AGACACTGGGGCCTACTTGAGGG - Intergenic
1119489859 14:75022145-75022167 AGACACCTGGGCCTACTTGAGGG + Intronic
1119676428 14:76558905-76558927 GGACACAGGGATCCACTTGAAGG + Intergenic
1120153221 14:81061619-81061641 AGACACTGGGGCCTGCTTGAAGG + Intronic
1120184535 14:81380803-81380825 AGACCCTGGGGCCCACTTGAGGG + Intronic
1120663352 14:87276993-87277015 AGACACTGGGGCCTACTTGAGGG - Intergenic
1125087081 15:35742711-35742733 AGACACTGGGACCTACTGGAGGG - Intergenic
1125173232 15:36791009-36791031 AGACACTGGGACCTACTCGAGGG - Intronic
1125302992 15:38277279-38277301 AGACACCAGGGCCTACTTGAGGG - Intronic
1125529179 15:40400586-40400608 AGACACTGGGGCCTACTTGAGGG - Intergenic
1126233916 15:46359724-46359746 AGACACCGGGACCTACTTGAGGG + Intergenic
1126502488 15:49361407-49361429 AGACACCAGGACCTACTTGAGGG - Intronic
1126659295 15:51016435-51016457 AGACACTGGGGGCTCCTTGAGGG + Intergenic
1126893859 15:53237030-53237052 AGACACTGGGACCTACTTGAAGG + Intergenic
1126993346 15:54409539-54409561 AGACATTGGGACCTCCTTGAGGG - Intronic
1127025526 15:54801118-54801140 AGACACCTGGTCCCCCTTGCTGG - Intergenic
1127029239 15:54843542-54843564 AGACACAAGGAAACCCTTGAAGG + Intergenic
1127055137 15:55123660-55123682 AGACACTGGGGCCTACTTGAGGG + Intergenic
1127136538 15:55929495-55929517 AGACACCGCGGCCTGCTTGAGGG - Intronic
1127182932 15:56442718-56442740 AGACACTGGGGCCTACTTGAGGG + Intronic
1127245762 15:57172609-57172631 AGACACGGGGGCCTCCTTGAAGG + Intronic
1127320650 15:57841873-57841895 AGACACCAGGGCCTTCTTGAGGG - Intergenic
1127696496 15:61453097-61453119 AGACACCGGGGCTTACTTGATGG - Intergenic
1128850467 15:70949973-70949995 AGACACTGGGGACCACTTGATGG - Intronic
1129597210 15:76974386-76974408 AGCCACCCGGACCTCCTTGTGGG - Intergenic
1129655545 15:77522549-77522571 AGACACAGGGGCCAGCTTGAAGG + Intergenic
1129956594 15:79642767-79642789 AGACACCAGGGCCTACTTGAGGG + Intergenic
1129965681 15:79733413-79733435 AGACACCAGGGCCTACTTGAGGG + Intergenic
1130181067 15:81629050-81629072 ACACACCGGGACCTCCTGGGGGG + Intergenic
1130189263 15:81716463-81716485 AGACACTGGGACCTACTTGAGGG - Intergenic
1130820600 15:87491215-87491237 AGACACTGGGACCTACTTGCGGG - Intergenic
1131076636 15:89499374-89499396 GGAACCCGGGACCCCCTTGGGGG + Intergenic
1131956180 15:97738684-97738706 AGACACCAGGGCCTACTTGAGGG - Intergenic
1131982918 15:98012994-98013016 AGACGCTGGGACCTACTTGAGGG + Intergenic
1131984456 15:98027866-98027888 AGACACTGGGACCTACTTGAGGG + Intergenic
1132288652 15:100684159-100684181 ACACACTGGGGCCTCCTTGAGGG - Intergenic
1132601082 16:773302-773324 AGACACAGGGTCCCCCTGGGGGG + Intronic
1133657307 16:7878309-7878331 AGACACCAGGATCTACTTGAGGG + Intergenic
1134373686 16:13649736-13649758 AGACACCAGGACCTAGTTGAGGG - Intergenic
1134391904 16:13827741-13827763 AGACACTGGCACCTTCTTGAGGG - Intergenic
1134564856 16:15242697-15242719 AGACACTGGGTCCTACTTGAAGG + Intergenic
1134737640 16:16514001-16514023 AGACACTGGGTCCTACTTGAAGG - Intergenic
1134766672 16:16764869-16764891 AGACACTGGGACCTGCTTGAGGG - Intergenic
1134929865 16:18198159-18198181 AGACACTGGGTCCTACTTGAAGG + Intergenic
1135007467 16:18839352-18839374 AGACACTGGGGCCTACTTGAGGG - Intronic
1135483955 16:22847143-22847165 AGACACTGGGGCACACTTGAGGG - Intronic
1135622158 16:23965154-23965176 AGACACTGAGACCTCCTTGAGGG - Intronic
1135966992 16:27043957-27043979 AGACACCGGGGCCTACTTAAGGG - Intergenic
1136075337 16:27813252-27813274 AGACACCAGGACCTACTTGAAGG - Intronic
1136640585 16:31561626-31561648 AGACACTGGGGCCTACTTGAGGG + Intergenic
1136678014 16:31931953-31931975 AGACATCAGGACCTACTTGAGGG + Intergenic
1137375782 16:47950549-47950571 AGACACTGGGACCGACTTGAGGG - Intergenic
1137837145 16:51603470-51603492 AGACACTGGGGCCTACTTGAGGG - Intergenic
1138058082 16:53857245-53857267 AGACACTAGGGCCCACTTGAGGG - Intronic
1138631541 16:58298448-58298470 AGACACTGGGGCCTTCTTGAGGG - Intronic
1138921749 16:61538878-61538900 AGACACCGTGTCCTCCATGAGGG + Intergenic
1138983904 16:62303599-62303621 AGGCACTGGGACCTACTTGAGGG + Intergenic
1139087498 16:63605264-63605286 AGACACTGGGATCTACTTGAAGG + Intergenic
1139173119 16:64654827-64654849 AGACACCAAGGCCCACTTGAGGG + Intergenic
1139275399 16:65723200-65723222 AGACACCAGGACCCACTTGAGGG - Intergenic
1139956372 16:70694974-70694996 TGACAGCAGAACCCCCTTGAAGG - Intronic
1140004236 16:71059611-71059633 AGACACTGGGGCCTACTTGAGGG + Intronic
1140255941 16:73336396-73336418 AGACACAGGGGCCTCCCTGAGGG - Intergenic
1140656482 16:77145497-77145519 AGACACTGGGACCTACCTGAGGG - Intergenic
1140947651 16:79784916-79784938 AGACACCGGTCCCTACTTGAGGG + Intergenic
1140974714 16:80048123-80048145 AGACACTGGGGCCCACTGGAAGG + Intergenic
1141311673 16:82919370-82919392 AGACACTGGGACCTATTTGAGGG - Intronic
1142180757 16:88668400-88668422 AGACACGGGGGTCCACTTGAGGG - Intergenic
1143039291 17:4021160-4021182 AAAAAGCTGGACCCCCTTGAGGG - Exonic
1143211804 17:5193563-5193585 AGACACCGGGATCCTCTGGGAGG + Intergenic
1143648081 17:8245131-8245153 AGACACTGGGTCCTACTTGAGGG + Intronic
1143872779 17:9969584-9969606 AGCCACCTGGACTCCCATGATGG + Intronic
1144079838 17:11753974-11753996 GGACACTGGAGCCCCCTTGAGGG - Intronic
1144695661 17:17302416-17302438 AGACACGGTGACCTACTTGAGGG + Intergenic
1145720776 17:27070498-27070520 AGACACTGGGGCCTACTTGAGGG + Intergenic
1146622567 17:34410814-34410836 AGACACCAGGACCTACTTGAGGG + Intergenic
1146930745 17:36776177-36776199 AGACACCGGGGCCTGCTGGAGGG + Intergenic
1148395793 17:47307157-47307179 AGACACTGGGACCTACTTGAGGG - Intronic
1148967098 17:51445286-51445308 AGACACTGGGACCTCTTTGAGGG + Intergenic
1149014829 17:51896251-51896273 AGACACTGGGGCCTCCTTGAGGG - Intronic
1149114357 17:53073973-53073995 AGACACTGGGATCTTCTTGAGGG - Intergenic
1149128187 17:53260884-53260906 AGACACCAGGGCCTACTTGAGGG + Intergenic
1149366974 17:55954419-55954441 AGACACTGGAGCCTCCTTGAGGG - Intergenic
1149395227 17:56234511-56234533 AGACACCGGGACCTACTTGAGGG - Intronic
1149742037 17:59055755-59055777 AGACACTGGGGCCTACTTGAGGG + Intronic
1149940432 17:60859354-60859376 AGACACCGGGGCCTACTTGAGGG - Intronic
1149948054 17:60952779-60952801 AGACACTGGGGCCTCCTTGAGGG - Intronic
1150028298 17:61702468-61702490 AGACACCAGGGCCTACTTGAGGG - Intronic
1150066983 17:62118823-62118845 AGACACTGGGGCCTACTTGAGGG + Intergenic
1150198579 17:63328170-63328192 AGACACTGGGGCTCACTTGAGGG + Intronic
1150423747 17:65060050-65060072 AGACACTGGGACCTACTTGAGGG + Intergenic
1150450531 17:65263355-65263377 AGACACTGGGAACCACTAGATGG + Intergenic
1152054407 17:78012322-78012344 AGACACTGGGTTCTCCTTGAGGG + Intronic
1153064161 18:1026169-1026191 AGACACTGGGGCCTGCTTGAGGG + Intergenic
1153348672 18:4055443-4055465 CGACACCGGGGCCCACTTGAGGG - Intronic
1153411223 18:4795580-4795602 AGACACTGGGACCTACCTGAGGG + Intergenic
1153760387 18:8325324-8325346 AGACACTGGGACCTACCTGAGGG - Intronic
1154036933 18:10812359-10812381 GGACACCGGGGCCTACTTGAGGG + Intronic
1154114727 18:11602861-11602883 AGACACTAGGACCCACTTGAGGG + Intergenic
1154357837 18:13635790-13635812 AGACCCAGGGACCACCCTGAGGG - Intronic
1154503585 18:15009925-15009947 AGACACTGGGAACTACTTGATGG + Intergenic
1155090775 18:22507988-22508010 AGACACTGGAACCTACTTGAGGG + Intergenic
1155180717 18:23343724-23343746 TGACACCGGGGCCTACTTGAGGG - Intronic
1155608465 18:27635310-27635332 AGACACGGGGACCCACTTGAGGG + Intergenic
1155773737 18:29732560-29732582 AGACACTGGGGCCTACTTGAGGG - Intergenic
1155861787 18:30910675-30910697 AGACACTGGGACCTCTTTGAGGG + Intergenic
1156212105 18:34955871-34955893 AGACACAGGGGCCTGCTTGAGGG + Intergenic
1156618733 18:38822340-38822362 AGACACCAGGGCCTACTTGAAGG + Intergenic
1156715377 18:40002703-40002725 AGACACTGGGATCTACTTGAAGG + Intergenic
1157084338 18:44563626-44563648 AGACACCGGGGCCTGCTTGAGGG + Intergenic
1157235895 18:45965279-45965301 AGACACCAGGGCCTACTTGAGGG + Intronic
1157559777 18:48638047-48638069 AGACAGAGGCACCCCCTAGAAGG - Intronic
1157698164 18:49741228-49741250 AGACACCAGGGCCTACTTGAGGG - Intergenic
1157778235 18:50414103-50414125 AGACACCAGGGCCTACTTGAGGG + Intergenic
1157826098 18:50813818-50813840 AGACACCAGGGCCTACTTGAGGG + Intronic
1157938505 18:51899202-51899224 AGACACCAGGGCCTACTTGAAGG - Intergenic
1157987793 18:52459359-52459381 AGACACCGGTACCTACTTGAGGG - Intronic
1158057026 18:53293632-53293654 AGACACCAGGGCCTACTTGAAGG - Intronic
1158313437 18:56184320-56184342 AGGCACCGGGGCCTGCTTGAGGG - Intergenic
1158749163 18:60238920-60238942 AGACACTGGAACCTACTTGATGG - Intergenic
1158922463 18:62208668-62208690 AGACACTGGGGCCAACTTGAAGG - Intronic
1159063578 18:63542802-63542824 AGATACTGGGACCTACTTGAGGG - Intergenic
1159485115 18:69045766-69045788 AGACACTGGGACCTACTTGAGGG - Intronic
1160112222 18:76044416-76044438 AGACACTGGGACGTACTTGAGGG + Intergenic
1160138879 18:76300990-76301012 AGACACTAGGACCTGCTTGAGGG + Intergenic
1160218851 18:76957671-76957693 ACACACTGGGGCCTCCTTGAGGG - Intronic
1161720732 19:5900975-5900997 AGACCCCGGGGCACCCTTGGAGG + Intronic
1162534163 19:11253353-11253375 AGCCACCTGGACCACCTAGATGG - Intronic
1164509294 19:28884425-28884447 AGACACCGAGGCCTGCTTGAGGG - Intergenic
1164531493 19:29051672-29051694 AGACACCAGGGCCTACTTGAGGG - Intergenic
1165207967 19:34207471-34207493 AGCCACTGGGACTCCCTTGGAGG - Intronic
1165968090 19:39601673-39601695 ACACACTGGGGCCTCCTTGAGGG + Intergenic
1166176237 19:41073320-41073342 AGACACTGGGGCCTCCCTGAGGG + Intergenic
1166398646 19:42461555-42461577 AGACACTGGGGCCTACTTGAGGG - Intergenic
1166408999 19:42543771-42543793 AGACACCGAGACTCCCAGGAGGG - Intronic
1167189229 19:47972449-47972471 AGACACCAGGGCCCACTGGATGG - Intronic
1167716958 19:51148347-51148369 AGACACTGGGGCCCACTTGAAGG - Intronic
1167764760 19:51474410-51474432 AGACACTGGGGCCTCCTTGAGGG - Intergenic
1168184419 19:54690022-54690044 ACACAGGGGGACCTCCTTGAGGG - Intronic
1168645465 19:58056468-58056490 AGACACCGGGACACCATTGTGGG + Intergenic
925493166 2:4418410-4418432 AGACACTGGGGCCCACTTGAGGG + Intergenic
925661350 2:6206418-6206440 AGACACCAGGGCCTGCTTGAGGG - Intergenic
926548916 2:14277200-14277222 AGACACCAGGACCTACTTGAGGG - Intergenic
926595237 2:14782938-14782960 AGACACTGAGGCCTCCTTGAGGG + Intergenic
926877543 2:17498904-17498926 AGACACTGGGACCTACTTGAAGG - Intergenic
927046621 2:19285616-19285638 AAACACTGGGACCTACTTGAGGG + Intergenic
927078499 2:19603661-19603683 AGACACCAGGGCCTACTTGAGGG + Intergenic
927165625 2:20317715-20317737 AGACATAGGGGCCTCCTTGAGGG - Intronic
927273491 2:21239764-21239786 AGACACTGGGGCCTACTTGAGGG - Intergenic
927381962 2:22489590-22489612 AGACACCAGGATCTACTTGAGGG + Intergenic
927420025 2:22921019-22921041 AGACACCGGGACCTAGTTGAGGG + Intergenic
927840073 2:26435581-26435603 AGACACTGGGGCCCACTTGAGGG - Intronic
928049762 2:27978801-27978823 AGACACTGGGGCCTACTTGAGGG - Intronic
928181105 2:29069516-29069538 AGACACTGGGGCCTCCTTGAGGG + Intronic
928503411 2:31922640-31922662 AGACACCGAGACCTACTGGAGGG - Intronic
928693554 2:33825227-33825249 AGACACCGGAGCCTACTTGAGGG - Intergenic
928755117 2:34515328-34515350 AGACATTGGGACCAACTTGAGGG + Intergenic
928814665 2:35278241-35278263 AGACACCAGGGCCTACTTGAGGG - Intergenic
928886138 2:36150657-36150679 AGACACTGGGATCTACTTGAGGG + Intergenic
929207456 2:39313381-39313403 AGACACTGGGGCCTGCTTGAGGG - Intronic
929255318 2:39804534-39804556 AGACACAGGGGCCTACTTGAGGG - Intergenic
930345263 2:50172362-50172384 AGACACAGGGAGGCCCTTGAAGG + Intronic
930365611 2:50435784-50435806 AGACACTGGGGCCTTCTTGAGGG + Intronic
931677027 2:64707625-64707647 AGACACTGGGGCCTACTTGAGGG + Intronic
931921669 2:67023779-67023801 AGACACCAGGGCCTACTTGAGGG + Intergenic
932166250 2:69510208-69510230 AGACGCTGGGGCCTCCTTGAAGG - Intronic
932222569 2:70011087-70011109 ACACACTGGGACCTCCTTGAGGG + Intergenic
932296548 2:70628408-70628430 AGACACTGTGGCCTCCTTGAGGG - Intronic
932506315 2:72235386-72235408 AGACACCAGGGCCTACTTGAAGG + Intronic
932511486 2:72297387-72297409 AGACACTGGGGCCTACTTGAGGG - Intronic
932647446 2:73518126-73518148 AGACACTGGGGCCTACTTGAGGG - Intronic
933355492 2:81205270-81205292 AGACACCAGGGCCTACTTGAGGG - Intergenic
933451274 2:82455262-82455284 AGACACTGGGGTCCACTTGAGGG + Intergenic
933498232 2:83078356-83078378 AGACACTGGGGCCCACTTGAGGG - Intergenic
933579909 2:84113797-84113819 AGACACTGGGACCTACTTGTGGG - Intergenic
933587814 2:84199163-84199185 AGACACTGGGGCCTACTTGAGGG - Intergenic
936868242 2:117102512-117102534 AGACACTGGGGCCTCCTTGAGGG - Intergenic
937027128 2:118708558-118708580 AGACACCGAGGCCTACTTGAGGG + Intergenic
937102322 2:119281283-119281305 AGACACCGAGGCCTACTTGAGGG - Intergenic
937694199 2:124789564-124789586 AGACACTGGGTCCTACTTGAGGG - Intronic
938252504 2:129826911-129826933 TGACACCGGGACCTACATGAGGG + Intergenic
938502759 2:131840056-131840078 AGACACTGGGAACTACTTGATGG + Intergenic
938866694 2:135429365-135429387 AGACACTGGGGCCTACTTGAGGG + Intronic
938912813 2:135901077-135901099 AGACACCGGGGCCTACTTGAGGG + Intergenic
939093313 2:137803806-137803828 AGACACTGGGTCCTACTTGAGGG + Intergenic
939197097 2:138986805-138986827 AGACACCAGGACATACTTGAGGG - Intergenic
939315500 2:140544482-140544504 AGACACTGGGACCCACTGGAGGG - Intronic
939526150 2:143296826-143296848 AGACACTGGGATCTACTTGAGGG - Intronic
939976523 2:148723005-148723027 AGACACTGGGACCTCCTTCAGGG + Intronic
940208716 2:151234351-151234373 AGACACCAGGGCCCACTTGAGGG + Intergenic
940527049 2:154829289-154829311 AGACACCAGGGCCTACTTGAGGG - Intronic
940708486 2:157133314-157133336 AGACACTGGGGCCTACTTGAGGG + Intergenic
941239859 2:163023877-163023899 AGCCACAGGGACCTACTTGAGGG - Intergenic
941418990 2:165258915-165258937 AGGCACTGGGACCTACTTGAGGG + Intronic
941566007 2:167109030-167109052 AGACACTGGGGCCTACTTGAGGG - Intronic
941639068 2:167967956-167967978 AGACACCAGGGCCTACTTGAGGG - Intronic
942002158 2:171658850-171658872 AGACACGGGGGCCTACTTGAGGG + Intergenic
942159102 2:173163286-173163308 AGACACAGGGATCTACTTGAAGG - Intronic
942824111 2:180153321-180153343 AGACACTGGGGCCTACTTGAGGG - Intergenic
942868881 2:180711054-180711076 AGACACTGGGGCCTACTTGAAGG - Intergenic
942908553 2:181213065-181213087 AGACACTGGGGCCTACTTGAGGG + Intergenic
942917578 2:181330188-181330210 AGACACTGGGATCTACTTGAGGG + Intergenic
942963986 2:181867141-181867163 AGACACTGGGGTCTCCTTGATGG + Intergenic
943056946 2:182993705-182993727 AGACACCAGGGCCTACTTGAAGG + Intronic
943124463 2:183779427-183779449 AGACACTGGGGCCTACTTGAGGG - Intergenic
943307293 2:186279335-186279357 AGACACTGGGGCCTACTTGAGGG - Intergenic
943322368 2:186461463-186461485 AGACACTGGGATCTACTTGATGG + Intergenic
943500822 2:188687447-188687469 AGACACTGGGGCCTACTTGAGGG - Intergenic
943611479 2:190039681-190039703 AGACACCGGGGTCTACTTGAGGG - Intronic
944058014 2:195543852-195543874 AGACACCAGGGCCTACTTGAGGG + Intergenic
944085848 2:195847473-195847495 AGACACTGGGGCCTACTTGAGGG + Intronic
944336056 2:198536625-198536647 AGACACTGGGGCCCACTTGAGGG + Intronic
944371389 2:198987395-198987417 AGACACTGGGGCCTGCTTGAGGG + Intergenic
944437100 2:199702119-199702141 AGACACCGGGGCCTGCTCGAAGG + Intergenic
944471797 2:200061615-200061637 AGACACCAGGGCCTACTTGAAGG + Intergenic
944546268 2:200802057-200802079 AGACACTGGGGCCTACTTGAGGG + Intergenic
944576361 2:201094862-201094884 AGACACTGGGATCTACTTGAAGG + Intergenic
944630608 2:201619984-201620006 AGACACTGGGGCCTACTTGACGG + Intergenic
944940287 2:204617705-204617727 AGACATCAGGGCCTCCTTGAGGG - Intronic
944943253 2:204653100-204653122 AGACACTGGGATCTTCTTGAAGG + Intronic
945798591 2:214395689-214395711 AGACACCAGGGCCTACTTGAGGG - Intronic
946218852 2:218208795-218208817 AGACACCGGGGCCTACTTGAGGG - Intergenic
946884855 2:224212840-224212862 AGACACTGGGGCCTCCCTGAGGG - Intergenic
947953165 2:234165217-234165239 AGACACCGGGGCCTACTGGAGGG - Intergenic
948231041 2:236349705-236349727 AGGCACTGGGGCCTCCTTGAGGG + Intronic
1169177304 20:3528568-3528590 AGACACCGGGACCTGCTTGAGGG + Intronic
1169514682 20:6303057-6303079 AGACACCGGGACCTACCTGAGGG - Intergenic
1169947597 20:11006030-11006052 AGACACTGGGGCCTGCTTGAGGG - Intergenic
1170103900 20:12732996-12733018 AGACACCAGGACCTACTTAAGGG + Intergenic
1170108645 20:12780546-12780568 ACACACTGGGACCTACTTGAGGG - Intergenic
1170143241 20:13146257-13146279 AGACACTGGGATCTGCTTGAGGG + Intronic
1170190871 20:13643704-13643726 AGACACCCGGACCTACTTGAAGG - Intergenic
1170378203 20:15726090-15726112 AGACACTGGGGCCTACTTGAGGG - Intronic
1170798093 20:19567487-19567509 AGACACTGGGACCTACTTGAGGG + Intronic
1171138557 20:22720544-22720566 AGACACCTGGGACCCCTTGAGGG - Intergenic
1171232512 20:23498927-23498949 AGCCACTGGGAGCCCCTGGAAGG - Intergenic
1171937798 20:31292599-31292621 AGACACTGGGGCCTACTTGAGGG + Intergenic
1172875114 20:38159339-38159361 ACACACTGGGGCCTCCTTGAGGG + Intronic
1174402368 20:50282926-50282948 AGACTCCGGGTCTACCTTGAAGG - Intergenic
1174405173 20:50298281-50298303 AGACACAAGGACACCCTTGGGGG - Intergenic
1174683379 20:52430174-52430196 AGACACTGGGGCCTACTTGAGGG + Intergenic
1175282357 20:57812472-57812494 ACATACTGGGACCCACTTGAGGG - Intergenic
1175426933 20:58873777-58873799 AGACACTGCTACTCCCTTGATGG + Intronic
1175513381 20:59551106-59551128 AGACACTGGGACCTACTGGAGGG + Intergenic
1175668461 20:60880356-60880378 AGACACTGGGGCCTACTTGAGGG + Intergenic
1176915601 21:14621824-14621846 AGGGTCAGGGACCCCCTTGAGGG - Intronic
1177128484 21:17227301-17227323 AGACACTGGGGCCTACTTGAGGG + Intergenic
1177370948 21:20202463-20202485 AGACACCGGGGCCTACTTGATGG + Intergenic
1177940317 21:27402170-27402192 AGACACCGGGCCCTACCTGATGG - Intergenic
1178203449 21:30435725-30435747 AGACACTGGGATCTACTTGAGGG - Intergenic
1178212108 21:30547447-30547469 AGACACTGGGACCTACCTGAGGG - Intronic
1178346702 21:31834947-31834969 AGACACCGGGGCCTGTTTGAGGG + Intergenic
1178362977 21:31965279-31965301 AGACACTGGGGCCCACTTGAGGG + Intronic
1178489524 21:33040241-33040263 AGATACCAGGACCTACTTGAGGG - Intergenic
1178858707 21:36271651-36271673 AAACACCGGGACCCCTTAGCTGG + Intronic
1180476254 22:15711410-15711432 AGACACTGGGGCCTACTTGAGGG - Intronic
1182591145 22:31381122-31381144 AGACACTGGGACCTACTTGAGGG - Intergenic
1184647624 22:45904684-45904706 ACACACCGGGGCCTACTTGAGGG - Intergenic
949225464 3:1688428-1688450 AGACTCTGGGACCTACTTGAGGG - Intergenic
949297768 3:2546477-2546499 AGGCACTGGGGCCTCCTTGAGGG + Intronic
950237717 3:11338118-11338140 AGACACTGGGGCCTACTTGAGGG - Intronic
950775860 3:15349796-15349818 AGACACCGGAGCCTACTTGAGGG + Intergenic
950812700 3:15664837-15664859 AGACACTAGGGCCCACTTGAGGG + Intergenic
951015357 3:17725875-17725897 AGACACTGGGGCCTACTTGAGGG - Intronic
951166953 3:19494014-19494036 AGACACTGGGGCCTACTTGAGGG - Intronic
951275717 3:20683232-20683254 AGACACAGGGCCCTACTTGAGGG + Intergenic
951309005 3:21100680-21100702 AGATACCAGGACCCACTTGAGGG - Intergenic
952106149 3:30071491-30071513 AGACACTGGGGTCCACTTGAGGG + Intergenic
952228096 3:31399935-31399957 AGACACTGGGATCTGCTTGAGGG - Intergenic
952547303 3:34433994-34434016 AGACACTGGGGCCTACTTGAGGG + Intergenic
952565927 3:34657795-34657817 AGACACTGGGGCCTACTTGAGGG - Intergenic
952877143 3:37955671-37955693 AGACACTGGGGCCTACTTGAGGG + Intronic
953030058 3:39173753-39173775 AGACACTGGGGCCTACTTGAGGG - Intergenic
953079642 3:39603759-39603781 AGACATTGGGACCTTCTTGAGGG - Intergenic
953104744 3:39866155-39866177 AGACACTGGGGCCTACTTGAGGG + Intronic
953225858 3:41019868-41019890 AGACACTGGGGCCCACTTGAGGG + Intergenic
953603683 3:44392485-44392507 AGACACTGGGACCCACTTGAAGG - Intronic
953745223 3:45568800-45568822 AGACACTGGGGCCTGCTTGAGGG - Intronic
953818804 3:46186000-46186022 AGACACTGGGGCCTACTTGAAGG - Intronic
954037065 3:47856710-47856732 AGACACCGCGCCCGCCCTGAGGG + Intronic
955141217 3:56271769-56271791 AGACACTGGGACCTACTTGAGGG - Intronic
955245183 3:57218266-57218288 AGACACTGGGGCCTGCTTGAGGG - Intronic
955595565 3:60586824-60586846 AGACAATGGGACCTGCTTGAGGG + Intronic
956372383 3:68577414-68577436 AGACACTGGGGCCTACTTGAGGG + Intergenic
956447358 3:69338664-69338686 AGACACCGAGGCCTACTTGAGGG + Intronic
956577459 3:70768976-70768998 AGATACCGGGGCCTACTTGAGGG - Intergenic
956578024 3:70777427-70777449 AAACACTGGGGCCTCCTTGAGGG + Intergenic
957479974 3:80780224-80780246 AGACACCAGGAGCTACTTGAAGG + Intergenic
957484475 3:80840545-80840567 ATACACTGGGACCTACTTGATGG + Intergenic
957876084 3:86148436-86148458 AGACACTGGGGCCTACTTGAAGG + Intergenic
957992097 3:87639185-87639207 AGACACTGGGAACCACTAGATGG - Intergenic
958021951 3:88008346-88008368 AGACACTGGGGCCTACTTGAAGG - Intergenic
958085537 3:88801364-88801386 AGACACCAGGGCCTCCTGGAGGG - Intergenic
958136729 3:89503629-89503651 AGACACCGGGGCCTCTTGGAGGG + Intergenic
958140532 3:89556793-89556815 AGACACTGGGGCCTACTTGATGG + Intergenic
958688345 3:97427899-97427921 AGACACTGGGGCCTACTTGAGGG + Intronic
958874738 3:99603295-99603317 AGACACCGGGACCTACTTGAGGG - Intergenic
958875344 3:99609884-99609906 AGACACTGGGGCCTACTTGAGGG - Intergenic
959451394 3:106507407-106507429 AGACACCAGGGCCTACTTGAGGG - Intergenic
960033815 3:113083100-113083122 AGACACTGGGGCCTCCTTGAGGG + Intergenic
960145944 3:114202698-114202720 AGACACCAGGACCTACTTAAGGG + Intergenic
960778400 3:121288951-121288973 AGACACTGGGGCCTACTTGAGGG + Intronic
960930622 3:122845125-122845147 AGACACTGGGACCAACTTGAGGG - Intronic
961245309 3:125446454-125446476 AGACACCAGGGCCTCCTTGAAGG - Intergenic
961417193 3:126767756-126767778 AGACACTGGGGCCTACTTGAGGG - Intronic
961578316 3:127856716-127856738 AGACACCGGGACCTACTTGAAGG - Intergenic
961850595 3:129813625-129813647 AGACACCAGGGCCTACTTGAGGG + Intronic
962468491 3:135683627-135683649 AGACACTGGGGCCTACTTGAGGG + Intergenic
962513040 3:136121414-136121436 AGACACCAGGGCCTGCTTGAGGG + Intronic
962813520 3:138978812-138978834 AGACATTGGGGCCCACTTGAGGG + Intergenic
962832346 3:139155533-139155555 AGACACTGGGGCCTACTTGAAGG + Intronic
963035034 3:141018806-141018828 AGACACTGGGGCCTACTTGAGGG + Intergenic
963578087 3:147088469-147088491 AGACACGGGGGCCTACTTGAGGG - Intergenic
963609326 3:147445148-147445170 AGACACTGGGCTCCACTTGAGGG - Intronic
963674398 3:148290939-148290961 AGACACTGGGGTCTCCTTGAGGG + Intergenic
964193961 3:154040057-154040079 AGACACTGGGGCCTCCCTGAGGG + Intergenic
964366338 3:155954426-155954448 AGACACCAGGGCCTACTTGAGGG - Intergenic
964375272 3:156043085-156043107 AGACACTGGGGCCTCCTTGAAGG - Intronic
964868439 3:161287530-161287552 AGGCACTGGGACCTACTTGAGGG + Intergenic
964979672 3:162664496-162664518 AGACACTGGGATCTACTTGAGGG + Intergenic
965009489 3:163067530-163067552 AGACACTGGGATCTACTTGAGGG + Intergenic
965230472 3:166045042-166045064 AGACACTGGGGCCTGCTTGAGGG - Intergenic
965479262 3:169197145-169197167 AGACACCAGGACGCACTTTAGGG + Intronic
965877525 3:173345315-173345337 AGACACCAGGGCCTACTTGAAGG + Intergenic
966139137 3:176734618-176734640 AGACACTGGGACCTACTTGTGGG - Intergenic
966516151 3:180822889-180822911 AAACACCAGGGCCTCCTTGAAGG + Intronic
966572868 3:181466476-181466498 AGACACCGAGACCTAATTGAGGG - Intergenic
966691772 3:182748838-182748860 AGACACTGGGACCCATTTGAGGG + Intergenic
967184801 3:186935167-186935189 AGACACCAGGGCCTTCTTGAAGG - Intronic
967941914 3:194772692-194772714 ACACACCTGAACACCCTTGAGGG - Intergenic
968250868 3:197212068-197212090 AGACACTGGGATCTACTTGAGGG + Intronic
969656169 4:8499741-8499763 AGACATGGGGACCTACTTGAGGG + Intergenic
970039754 4:11782680-11782702 AGACACAGGGGCCTACTTGAGGG + Intergenic
970298257 4:14654626-14654648 AGACACTGGGGCCCACTTGAGGG + Intergenic
970555182 4:17224737-17224759 AGACACTGGGACCTCTTTGAGGG - Intergenic
970631607 4:17952899-17952921 AGACACTGGGGCCTACTTGAGGG - Intronic
970692222 4:18632852-18632874 GGACACTGGGACCTACTTGAGGG + Intergenic
970776011 4:19675075-19675097 AGACACTGGAACCTACTTGAAGG + Intergenic
971434942 4:26610611-26610633 AGACACCAGGGCCTACTTGATGG - Intronic
971521154 4:27552076-27552098 AGACACTGGGATCTACTTGAGGG - Intergenic
971628461 4:28956142-28956164 AGACACTGGGACCTACTTGAGGG + Intergenic
971644978 4:29188194-29188216 AGACATTGGGGCCCACTTGAGGG + Intergenic
971829507 4:31672414-31672436 AAACACTGGGGCCTCCTTGAGGG - Intergenic
971989669 4:33875915-33875937 AGACACCGGGACCTGCTTGAGGG - Intergenic
972010654 4:34176962-34176984 AGACACTGGGGCCTACTTGAGGG + Intergenic
972105946 4:35487468-35487490 AGACACTGGGTCCTACTTGAGGG + Intergenic
972377201 4:38483645-38483667 AGACACTGGGTCCTCCTTGAGGG - Intergenic
972659753 4:41104660-41104682 AGATACTGGGACCCACTTGAGGG - Intronic
972859906 4:43154830-43154852 AGACACCGGGGCCTAATTGAGGG - Intergenic
972900036 4:43672105-43672127 AGACACTGGGATCTGCTTGAGGG - Intergenic
972967615 4:44530791-44530813 AGACACCAGGGCCTACTTGAGGG - Intergenic
973143899 4:46801547-46801569 AGACACCAGGACCTACTTGAAGG + Intronic
973151630 4:46895470-46895492 AGACACTGGGACCTACTTGAGGG + Intronic
973694164 4:53473634-53473656 AGACACCAGGGCCTACTTGAGGG + Intronic
973740365 4:53913848-53913870 AGATACCGGGGCCTACTTGAGGG + Intronic
973761048 4:54116092-54116114 AGACACCAGGACCTACCTGAGGG - Intronic
973958665 4:56088304-56088326 AGACACCAGGGCCTACTTGAGGG - Intergenic
974515302 4:62900352-62900374 AGACACTGGGACCTACTTGAGGG + Intergenic
974546371 4:63313663-63313685 AGACATCGGGATCTACTTGATGG - Intergenic
974623757 4:64395834-64395856 AGACACTGGGGCCTACTTGAGGG - Intronic
974683177 4:65191351-65191373 AGACACCAGGGCCTACTTGAGGG - Intergenic
974765990 4:66347258-66347280 AGACACTGGGGCCTACTTGAGGG + Intergenic
974914612 4:68164141-68164163 AGACACTGGGGCCTACTTGAGGG + Intergenic
975090528 4:70397368-70397390 AGACACCAGGGCCTACTTGATGG + Intergenic
975093441 4:70429580-70429602 AGACACTGGGGCCTACTTGAGGG + Intergenic
975131243 4:70834953-70834975 AGACACCAGGGCCAACTTGAGGG - Intronic
975158391 4:71097183-71097205 AGACACTGGGACCTACTTAAGGG - Intergenic
975286190 4:72623780-72623802 AGACACTGGGACCTACTTGAAGG - Intergenic
976059971 4:81116194-81116216 AGGCACCAGGACCTACTTGAGGG - Intronic
976367935 4:84251083-84251105 AGACACTGGGACCTGCTTGAGGG + Intergenic
976452910 4:85212361-85212383 AGACACTGGGATCTACTTGAGGG - Intergenic
976470730 4:85425602-85425624 AGACACTGGGGCCCACTTGAGGG - Intergenic
976640218 4:87329925-87329947 AGACACAGGGGCCTACTTGAGGG - Intergenic
976793382 4:88905565-88905587 AGACACTGGGACCTCCTCGAGGG - Intronic
976815570 4:89144656-89144678 AGACACCGGGGCCTACTTGAGGG - Intergenic
977083802 4:92568732-92568754 AGACACTGGGACCTACTGGAGGG - Intronic
977266620 4:94863170-94863192 AGACACCGGGGCCTACTTGATGG + Intronic
977517776 4:98043932-98043954 AGACACTGGGGCCTACTTGAGGG - Intronic
977903618 4:102451170-102451192 AGACACTGGGGCCTACTTGAGGG + Intergenic
978053196 4:104229137-104229159 AGACACTGGGGCCTACTTGAGGG - Intergenic
978352036 4:107830039-107830061 AGACACAGGGGCCTACTTGAGGG - Intronic
978949491 4:114540460-114540482 AGACACTGGGGCCTCCTTGAGGG - Intergenic
979590603 4:122475269-122475291 AGACACTGGGGCCTACTTGAGGG - Intergenic
979709941 4:123767664-123767686 AGACACCTGGGCCTACTTGAGGG + Intergenic
980398201 4:132243657-132243679 AGACACCAGGGCCTACTTGAGGG + Intergenic
980405263 4:132346368-132346390 AGACACCAGGGCCTGCTTGAGGG + Intergenic
980447779 4:132933422-132933444 AGACACCAGGGCCTACTTGAGGG + Intergenic
980540193 4:134183438-134183460 AGACACGGGGGCCTACTTGAAGG + Intergenic
980669723 4:135988489-135988511 AGACACTGGGGCCTACTTGAGGG + Intergenic
980824684 4:138059333-138059355 AGACACTGGGGCCTACTTGAGGG - Intergenic
981079035 4:140619954-140619976 ACACACTGGGGCCTCCTTGAGGG - Intergenic
981217843 4:142192144-142192166 AGACACCAGGACCTACTTAAGGG + Intronic
981351322 4:143733206-143733228 AGAAACCAGGGCCCACTTGAGGG - Intergenic
982219108 4:153110015-153110037 AGACACTGGGGCCTACTTGAGGG + Intergenic
982690514 4:158542939-158542961 AGACACTGGGGCCTACTTGAGGG + Intronic
982928464 4:161370311-161370333 AGACACTGGGTCCTACTTGAGGG - Intergenic
983074962 4:163314881-163314903 AGACACTGGGAACTACTTGATGG - Intergenic
983155634 4:164344205-164344227 AGACACCAGGACCTACTTGAGGG + Intronic
983293161 4:165831997-165832019 AGACACCGGGGCCTACTTGAGGG - Intergenic
983404954 4:167316033-167316055 AGACACCAGGGCCTACTTGAGGG - Intergenic
983434218 4:167691309-167691331 AGACACTGGGGCCTACTTGAGGG - Intergenic
983439218 4:167759807-167759829 AGACACCCAGACCTCCTTGAAGG + Intergenic
983785551 4:171725700-171725722 AGATACCAGGGCCTCCTTGAGGG + Intergenic
984070979 4:175111861-175111883 AGACACCAGGGCCTACTTGAGGG + Intergenic
985239185 4:187911856-187911878 ACACACTGGGGCCTCCTTGAGGG - Intergenic
985810170 5:2077196-2077218 AGACACTGGGGCCTCCTGGAGGG + Intergenic
986194022 5:5521240-5521262 AGACACTGGGGCCTCCTGGAGGG + Intergenic
986229247 5:5846653-5846675 AGACACCGGGGCCTATTTGAGGG - Intergenic
986268318 5:6209816-6209838 AGACACCGGGGCGTACTTGAGGG + Intergenic
986845768 5:11751395-11751417 AGACACTGGGACCTATTTGAGGG - Intronic
986896661 5:12379175-12379197 AGACACCAGGGCCTACTTGAGGG - Intergenic
987072277 5:14349886-14349908 AGACACTAGGACCTACTTGAAGG - Intronic
987159524 5:15126722-15126744 AGACACCAGGGCCTACTTGATGG - Intergenic
987394528 5:17409705-17409727 AGACACCAGGGCCTGCTTGAGGG - Intergenic
987430488 5:17826725-17826747 AGACACTGGAGCCCACTTGAAGG + Intergenic
987850337 5:23344533-23344555 AGACACCGGGACCTACTTGAGGG + Intergenic
988004070 5:25385084-25385106 AGACACTGGGATCTACTTGAGGG - Intergenic
988097991 5:26642457-26642479 AGACACTGGGACCTACTTGAGGG + Intergenic
988201872 5:28078261-28078283 AGACACTGGGGCCTACTTGAGGG - Intergenic
988321375 5:29701484-29701506 AGACACCAGGTCCTACTTGAGGG - Intergenic
988329663 5:29818906-29818928 AGACACCAGGACCTACTTGAAGG - Intergenic
988979754 5:36555060-36555082 AGACACTGGGATCTACTTGAGGG - Intergenic
989298906 5:39864860-39864882 AGACACCGGGGCCTGCTTGAGGG - Intergenic
989413310 5:41144748-41144770 AGACACCAGGGCCGACTTGAGGG - Intronic
989538619 5:42592425-42592447 AGACACTGGCACCCACTTGGGGG - Intronic
990215004 5:53521154-53521176 AGACACTGGGGCCTACTTGAGGG + Intergenic
990497310 5:56361454-56361476 AGACACTGGGACCTACTTGAGGG - Intergenic
990611318 5:57459596-57459618 AGACACTGGGGCCTGCTTGAGGG + Intergenic
990687062 5:58316405-58316427 AGACACTGGGGCCTACTTGAGGG - Intergenic
990702943 5:58495270-58495292 AGACACTGGGGCCTACTTGAGGG + Exonic
990898208 5:60722653-60722675 AGACACCGGGGCCTACTTGAGGG + Intergenic
991027522 5:62046221-62046243 AGACACTGGGTCCTACTTGAGGG - Intergenic
991455630 5:66800524-66800546 AGACACTGGGGCCTGCTTGAGGG + Intronic
991933055 5:71774348-71774370 AGACACTGGGGCCTACTTGAGGG + Intergenic
992032360 5:72734455-72734477 AGACACCAAGACTCGCTTGAGGG - Intergenic
992305311 5:75431222-75431244 AGACACTGGGCCCTACTTGAGGG - Intronic
992558626 5:77928436-77928458 AGACACCAGGGCCTACTTGAGGG + Intergenic
992593314 5:78318678-78318700 AGACACTGAGGCCTCCTTGAGGG + Intergenic
992857999 5:80883615-80883637 TGACACTGGGGCCTCCTTGAGGG - Intergenic
993062406 5:83054665-83054687 AGACACTGGGGCCTACTTGAGGG + Exonic
993104034 5:83578313-83578335 AGACACTGGGGCCTACTTGAGGG + Intronic
993188072 5:84645818-84645840 AGACACCGGCAGGCCGTTGACGG + Intergenic
993362268 5:86992280-86992302 AGACACTGGGGCCTACTTGAGGG - Intergenic
993411944 5:87584953-87584975 AGACACTGGGACATACTTGAGGG - Intergenic
993413389 5:87598116-87598138 AGACACTGGGACCTACTTGAGGG - Intergenic
993697094 5:91074336-91074358 AGACACTGGGGCCTACTTGAGGG - Intronic
993797605 5:92286665-92286687 AGACACTGGGACCTACCTGATGG + Intergenic
993801426 5:92347633-92347655 AGACACTGGGATCTACTTGAGGG - Intergenic
994010622 5:94897839-94897861 CGACACTGGGGCCTCCTTGAGGG - Intronic
994303652 5:98177409-98177431 AGACACTGGCACCTACTTGAGGG - Intergenic
994330252 5:98496604-98496626 AGACACCAGGGCCTACTTGAGGG + Intergenic
994397408 5:99236553-99236575 AGACACTGGGGCCTACTTGAGGG + Intergenic
994433314 5:99696006-99696028 AGACACTGGGGCCTACTTGAGGG - Intergenic
994471295 5:100211533-100211555 AGACACCAGGGCCTACTTGAGGG + Intergenic
994558458 5:101334599-101334621 AGACACTGGGACCTTCTTGAGGG + Intergenic
995099945 5:108288092-108288114 AGACACCAGGGCCTACTTGAGGG + Intronic
995269983 5:110208911-110208933 AGACACTGGGGACTCCTTGAAGG - Intergenic
995312921 5:110733664-110733686 AGACACTGGGGCCTACTTGAGGG + Intronic
995380762 5:111530939-111530961 AGACACTGGGGCCTACTTGAGGG + Intergenic
995429447 5:112058045-112058067 AGACACTGGGATCTACTTGACGG + Intergenic
995775063 5:115716219-115716241 AGACACCGGGGCCTACTTGAGGG - Intergenic
995950929 5:117713111-117713133 AGATACTGGGACCTACTTGAGGG - Intergenic
995992899 5:118264124-118264146 AGACACTGGGGCCTACTTGAGGG - Intergenic
996081114 5:119259275-119259297 AGACACTGGGGCCTACTTGAGGG + Intergenic
997099736 5:130955928-130955950 AGACACTGGGGCCTACTTGAGGG - Intergenic
997188569 5:131906846-131906868 AGACACTGGGGCCTACTTGAGGG + Intronic
997250375 5:132384388-132384410 AGAAACCCTGTCCCCCTTGAGGG - Intronic
997913920 5:137904596-137904618 AGACACTGGGGCCTACTTGATGG + Intronic
998577405 5:143331766-143331788 AGACACTGGGGCCTACTTGAGGG + Intronic
998634763 5:143941135-143941157 AGACACTGGGCCCTACTTGAGGG - Intergenic
999054068 5:148554808-148554830 AGACACTGGGACCTACGTGAGGG - Intronic
999071054 5:148744580-148744602 AGACACTGGGACCTACTTGAGGG + Intergenic
999104287 5:149056272-149056294 AGACACTGGGATCTACTTGAGGG - Intronic
1000731904 5:164845197-164845219 AGACACTGGGGCCTACTTGAGGG - Intergenic
1000759011 5:165197909-165197931 AGACACTGGGAACTGCTTGAGGG + Intergenic
1000997878 5:167977152-167977174 AGACACTGGGTCCTACTTGAGGG + Intronic
1001206282 5:169766231-169766253 AGACACTGGGGCCTGCTTGAGGG - Intronic
1001503486 5:172257149-172257171 AGTCACTGGGACCTCCTTGAGGG - Intronic
1001657890 5:173367070-173367092 AGACACTGGGACCTATTTGAGGG - Intergenic
1001767973 5:174269403-174269425 AGACACCAGGACCTACTTGAGGG + Intergenic
1001849029 5:174947085-174947107 AGACATTGGGGCCTCCTTGAGGG + Intergenic
1001895152 5:175372369-175372391 AGACACTGGGACCTCCTTGAGGG - Intergenic
1002822954 6:745418-745440 AGACACCAGGGCCTACTTGAGGG + Intergenic
1002907287 6:1459893-1459915 AGACACCAGGGCCTGCTTGAGGG - Intergenic
1003032478 6:2614182-2614204 AGACACTGGGACCTACTGGAGGG - Intergenic
1003830391 6:10003664-10003686 AGACACTGGGGCCTACTTGAAGG + Intronic
1003993051 6:11506847-11506869 AGACATTGGGGCCTCCTTGAGGG + Intergenic
1004034082 6:11904940-11904962 AGACACTGGGATCTACTTGAGGG - Intergenic
1004059365 6:12177145-12177167 AGACACTGGGATCTACTTGAGGG + Intergenic
1004465436 6:15880831-15880853 AGACACTGAGGCCCCCTTGAGGG - Intergenic
1004549035 6:16628625-16628647 AGACACTGGGTCCTACTTGAGGG - Intronic
1004564698 6:16785338-16785360 AGACTCTGGGACCTACTTGAGGG + Intergenic
1004614320 6:17275685-17275707 AGACACTGGGGCCAACTTGACGG + Intergenic
1004766397 6:18732627-18732649 AGACACTGGCACCTACTTGAGGG + Intergenic
1004817613 6:19329635-19329657 AGACACTGGGTTCCACTTGAGGG - Intergenic
1005909685 6:30297549-30297571 AGACACCAGGACCTACTTGAGGG - Intergenic
1005922075 6:30411186-30411208 ACACACCGGGGCCTACTTGAAGG + Intergenic
1006073601 6:31515302-31515324 AGACACTGGGGCCTCCTTGAGGG + Intergenic
1006268101 6:32942098-32942120 AGACACTGGGCCCTACTTGAGGG - Intronic
1007055753 6:38882542-38882564 AGACACTGGGGCCTACTTGAGGG + Intronic
1007179828 6:39921940-39921962 AGACACTGGGACCTACTTGAGGG - Intronic
1007504954 6:42328506-42328528 AGACACTGGGGCCTGCTTGAGGG - Intronic
1007869945 6:45023741-45023763 AGACACTGGGGCCTACTTGAAGG + Intronic
1008049159 6:46882467-46882489 AGACACTGGGACTCCTTGGAAGG - Intronic
1008251753 6:49248455-49248477 AGACACCAGGACTTACTTGAGGG + Intergenic
1008372069 6:50744207-50744229 AGACACTGGGACCTACTTGAGGG - Intronic
1008642475 6:53478682-53478704 AGACACCAGCACCTACTTGAGGG - Intergenic
1008779525 6:55086204-55086226 AGACACTGGGGCCTACTTGAGGG + Intergenic
1009285260 6:61807648-61807670 AGACACTAGGGCCTCCTTGAAGG + Intronic
1009497391 6:64368104-64368126 AGACACCAGGACCTACTTGAAGG - Intronic
1009505172 6:64468664-64468686 AGACACCAGGACCTACTTGAAGG - Intronic
1009592010 6:65684901-65684923 AGACACCGGGGCCCACTTGAGGG - Intronic
1009646572 6:66410974-66410996 AGACACTAGGACCTACTTGAGGG + Intergenic
1010020071 6:71149275-71149297 AGACACTGGGGCCTACTTGAGGG + Intergenic
1010473580 6:76260378-76260400 AGACACTGGGGCCTACTTGAGGG - Intergenic
1010500839 6:76597732-76597754 AGACACCAGGGCCTTCTTGAGGG - Intergenic
1010610339 6:77946748-77946770 AGACACTGGAACCTACTTGAAGG - Intergenic
1010646659 6:78397173-78397195 AGACACCAGGGCCTACTTGAGGG - Intergenic
1010899421 6:81407884-81407906 AGACACTGGGATCTACTTGAGGG - Intergenic
1011102007 6:83732748-83732770 AGACACTGGGGCCTACTTGAGGG - Intergenic
1011281461 6:85681935-85681957 AGACACTAGGGCCTCCTTGAGGG - Intergenic
1011295534 6:85823347-85823369 AGACACTGGGGCCTACTTGAGGG + Intergenic
1011362542 6:86543358-86543380 AGACACTGGGACCTACTTGAAGG + Intergenic
1011922817 6:92602504-92602526 AGACACCAGGGCCTACTTGAGGG + Intergenic
1012170041 6:96005450-96005472 AGACATCGGTACCTACTTGAGGG + Intergenic
1012198712 6:96377974-96377996 AGACACCGGGACCTGCTAGAGGG - Intergenic
1012425237 6:99106897-99106919 AGACATTGGGGCCCACTTGAGGG - Intergenic
1012586524 6:100929889-100929911 AGATACCAGGACCTACTTGAGGG - Intergenic
1012604619 6:101142784-101142806 AGACACCAAGACCTTCTTGAGGG - Intergenic
1012707001 6:102544222-102544244 AGACACCGGGGCCTACTTGAAGG + Intergenic
1013316748 6:108950605-108950627 AGACACTGGGACCTACTTGAGGG + Intronic
1013376892 6:109526114-109526136 AGACACTGGGGCCTACTTGAGGG + Intronic
1013727616 6:113119058-113119080 AGACACTGGGCCCTACTTGAGGG + Intergenic
1013766576 6:113581002-113581024 AGACACTGGGGTCTCCTTGAGGG + Intergenic
1013816253 6:114102031-114102053 AGACACTGGGGCCTACTTGAGGG + Intronic
1013850045 6:114503244-114503266 AGCCACCGGGGCCTACTTGATGG - Intergenic
1014075453 6:117229875-117229897 AGACACAGGGGCCTACTTGAGGG - Intergenic
1014207349 6:118670390-118670412 AGACACCAGGGCCTACTTGAGGG - Intronic
1014335384 6:120127228-120127250 AGACACTGGGGCCTTCTTGAGGG - Intergenic
1014402388 6:121006638-121006660 AGACACTGGGGCCTACTTGAGGG + Intergenic
1014613770 6:123577307-123577329 AGACACTGGGGCCTACTTGAGGG - Intronic
1014693095 6:124586422-124586444 AGACACTGGGGCCTACTTGAGGG + Intronic
1015463090 6:133516217-133516239 AGACACTGGGGCCTACTTGAGGG + Intronic
1015488035 6:133793955-133793977 AGACACTGGGACCAACTTGAGGG - Intergenic
1015567682 6:134590442-134590464 AAACACCGGGGCCTACTTGAGGG - Intergenic
1015697639 6:135999426-135999448 AGACACTGGGGCCTACTTGAGGG - Intronic
1015743390 6:136483340-136483362 AGACACCAGGGCCTTCTTGAGGG + Intronic
1016119071 6:140325715-140325737 AGACACTGGGACCTACCTGAGGG - Intergenic
1016287921 6:142493949-142493971 AGACACTGGGGCCTCCCTGAGGG + Intergenic
1016578339 6:145597733-145597755 AGACACTGGGGCCTTCTTGAGGG - Intronic
1016608626 6:145963750-145963772 AGACTCCGGGAGCCGCTTGTGGG - Intronic
1016616886 6:146060409-146060431 AGACACCAGGGCCTACTTGAGGG - Intronic
1016636295 6:146295886-146295908 AGACTCTGGGGCCCCCTTGAGGG - Intronic
1016684692 6:146867914-146867936 AGACACTGGGACCTACTTGAGGG - Intergenic
1016704857 6:147094947-147094969 AGACACTGGGGCCTACTTGAAGG + Intergenic
1017261155 6:152389364-152389386 AGACACTGGTGCCTCCTTGAGGG - Intronic
1017305091 6:152908848-152908870 AGACACCAGGTCCTACTTGACGG - Intergenic
1017400976 6:154061649-154061671 AGACACCGGGGCTTACTTGAGGG + Intronic
1017615051 6:156237684-156237706 AGACACGGAGACCTACTTGAGGG + Intergenic
1017750182 6:157484124-157484146 AGACACTGGGGCCTTCTTGAGGG + Intronic
1017929862 6:158942374-158942396 AGACACCAGGGCCTACTTGAGGG - Intergenic
1017994006 6:159515376-159515398 AGACACTGGGGCTGCCTTGAGGG - Intergenic
1018132140 6:160741821-160741843 AGACACTGGGGCCTACTTGAGGG - Intronic
1018520059 6:164639135-164639157 AGACACCTGGGCCTCCTTGAGGG - Intergenic
1018675725 6:166220831-166220853 AGACACCGGGATCCCCAAGAGGG - Intergenic
1018734468 6:166677116-166677138 AGACACCTGGTAGCCCTTGAAGG - Intronic
1019183060 6:170204378-170204400 AGACACTGGGACCTACTTGAGGG - Intergenic
1019183204 6:170205529-170205551 AGACACTGAGACCTCCTTGAGGG + Intergenic
1019853407 7:3581971-3581993 AGACACCGGGGCCTACTTGAGGG + Intronic
1020075991 7:5259348-5259370 AGACACCAGGGCCTACTTGAGGG + Intergenic
1020375804 7:7484956-7484978 AGACACTGGGGCCCACTTGAAGG + Intronic
1020491362 7:8788292-8788314 AGACACCAGGTCCTACTTGAGGG - Intergenic
1020533958 7:9370510-9370532 AGACACTGGGTCCTACTTGAAGG + Intergenic
1020862408 7:13511276-13511298 AGACACTGGGATCTACTTGAGGG - Intergenic
1020939820 7:14518292-14518314 AGACACTGGGAACTCTTTGAGGG + Intronic
1021200513 7:17723802-17723824 AGACACTGGGATCTACTTGACGG - Intergenic
1021327965 7:19297734-19297756 AGACACCGGGGCCTACCTGAGGG + Intergenic
1021336525 7:19409469-19409491 AGACACTGGGGCCTACTTGAGGG - Intergenic
1021366151 7:19781311-19781333 AGACACCAGCACCTACTTGAGGG - Intergenic
1021773917 7:24032841-24032863 AGACACTGGGGCCTACTTGAGGG - Intergenic
1022739078 7:33104286-33104308 ACACACTGGGGCCCACTTGAGGG + Intronic
1022935413 7:35170358-35170380 AGACACTGGGGCCTACTTGAGGG + Intergenic
1022991421 7:35712010-35712032 AGACACTGGGGCCTACTTGAGGG + Intergenic
1023229610 7:38012833-38012855 AGACACCGGGGCCTGCTTAAGGG - Intronic
1023325265 7:39048371-39048393 AGACACTGGGGCCTACTTGAGGG - Intronic
1023571337 7:41575608-41575630 AGACACCGGGGCCTACTTGAGGG - Intergenic
1023640526 7:42252323-42252345 AGACACTGGGACCTACTTGAGGG + Intergenic
1023735168 7:43229457-43229479 AGACACTGGGATCTACTTGAGGG + Intronic
1023782861 7:43673975-43673997 AGACACCAGGACCTACTTAAAGG + Intronic
1024172899 7:46808940-46808962 AGACACAGGGGCCTACTTGAGGG + Intergenic
1024254587 7:47531087-47531109 AGACACCAGGGCCTACTTGAGGG + Intronic
1024423327 7:49196217-49196239 AGACACTGGGGCCTACTTGAGGG - Intergenic
1024726278 7:52200019-52200041 AGACACCGGGGCCTACTTGAGGG + Intergenic
1024848323 7:53677619-53677641 AGACACTGGGACCTTCTTGAGGG - Intergenic
1025061115 7:55809242-55809264 AGACACTGGGGCCTCCTTGAGGG + Intronic
1025616962 7:63128384-63128406 AGACACTGAGGCCTCCTTGAGGG + Intergenic
1026193549 7:68151554-68151576 AGACACTGGGGCCTCCTTGAGGG + Intergenic
1026209584 7:68292077-68292099 AGACACTGGGGTCTCCTTGAGGG + Intergenic
1026343783 7:69456430-69456452 AGACACTGGGAACTACTTGAAGG - Intergenic
1026422157 7:70250845-70250867 AGACACTGGGGCCTACTTGAGGG + Intronic
1026511874 7:71034175-71034197 AGACACCAGGACCTCCAAGATGG + Intergenic
1026576234 7:71573837-71573859 AGACACTGGGGCCTACTTGAGGG - Intronic
1027481606 7:78704984-78705006 AGACACTGGGGCCTACTTGAGGG + Intronic
1028218288 7:88162315-88162337 AGACACTGGGACCTATTTGAGGG + Intronic
1028640369 7:93035726-93035748 AGACACTGGGGCCTACTTGAGGG + Intergenic
1028860696 7:95646854-95646876 AGACACTGGGCCCTCCTTGAGGG - Intergenic
1028881953 7:95890409-95890431 AGATACTGGGGCCTCCTTGACGG + Intronic
1029412371 7:100422740-100422762 AGACACTGGGGCCTACTTGAGGG - Intronic
1029535447 7:101154886-101154908 AGTCACCGAGACCCCCTTCCCGG + Intronic
1029808717 7:103023956-103023978 AGACACCAGGATCTACTTGAGGG + Intronic
1029831371 7:103263127-103263149 AGACACTGGGGCCTACTTGAGGG + Intergenic
1029932551 7:104387951-104387973 AGACACTGGGGCCTACTTGAGGG - Intronic
1029955657 7:104636540-104636562 AGACACTGGGGCCTACTTGAGGG - Intronic
1030200432 7:106897540-106897562 AGACACTGGGATCTACTTGAGGG - Intronic
1030507111 7:110438475-110438497 AGACACCGGGGCCTACTTGAGGG - Intergenic
1030711149 7:112750924-112750946 AGATACTGGGACCTACTTGAGGG + Intergenic
1030718945 7:112846345-112846367 AGACACTGGGGCCTACTTGAGGG + Intronic
1030731903 7:112999968-112999990 AGACACTGGGACCTACCTGAGGG + Intergenic
1030732434 7:113006004-113006026 AGACACCAGGGCCTACTTGAGGG + Intergenic
1031010674 7:116523443-116523465 AGGCACTGGGGCCCACTTGAGGG - Intergenic
1031023883 7:116659280-116659302 AGACACTGGGGCCTACTTGAGGG - Intergenic
1031387760 7:121173414-121173436 AGATACTGGGACCTACTTGAAGG - Intronic
1031640560 7:124158687-124158709 AGACACTGGGGCCTACTTGAAGG + Intergenic
1031647748 7:124247478-124247500 AGACACCGGGGCCTACTTGAGGG - Intergenic
1031893038 7:127317208-127317230 AGACACTGGGGCCTACTTGAGGG + Intergenic
1031911638 7:127523041-127523063 AGACACTGGGGCCTACTTGAGGG + Intergenic
1032586981 7:133156004-133156026 AGACACTGGGACCTACTTGAAGG + Intergenic
1032625010 7:133582136-133582158 AGACACTGGGGCCTACTTGAGGG - Intronic
1032625388 7:133586246-133586268 AGACACCAGGGCCTGCTTGAGGG - Intronic
1032647547 7:133841823-133841845 AGACACCGGGACCTACTTGAGGG - Intronic
1032775054 7:135104076-135104098 AGACACTGGGGCCTACTTGAGGG - Intronic
1032875648 7:136035227-136035249 AGACACTGGGGCCAACTTGAGGG - Intergenic
1033000390 7:137497790-137497812 AGACACCAGGGCCTCCTTGATGG + Intronic
1033143494 7:138849725-138849747 AGACATTGGGGCCCACTTGAGGG - Intronic
1033769630 7:144535165-144535187 AGACACTGGGGCCCACTTGAGGG - Intronic
1033877334 7:145838568-145838590 AGACACCAGGGCCTACTTGAGGG + Intergenic
1034156184 7:148957932-148957954 AGACACTGGGATCTGCTTGAGGG - Intergenic
1034478193 7:151300838-151300860 AGACACCAGGTCCCCATTGCTGG + Intergenic
1035142297 7:156774996-156775018 AGACACTGGGGCCTACTTGAAGG + Intronic
1035195480 7:157216515-157216537 AGACACTGGGATCTACTTGAAGG - Intronic
1035241329 7:157531648-157531670 AGACACTGGGGCCTACTTGAGGG - Intergenic
1036141773 8:6215621-6215643 AGACACCGGGGCCTGCTTGTGGG - Intergenic
1036634101 8:10536846-10536868 AGACACCAGGACCTACTTAAAGG + Intronic
1037177082 8:15960550-15960572 GGACACCAGGACCTACTTGAGGG - Intergenic
1037261074 8:17009034-17009056 AGACACAGGCACCTACTTGAGGG + Intergenic
1037316195 8:17601628-17601650 AGACACAGGGGCCCACTTGAAGG - Intronic
1037373021 8:18200516-18200538 AGACACCGGGATCTACTTAAGGG + Intronic
1037491758 8:19402986-19403008 AGACACCGGGGCCTACTTGAGGG + Intergenic
1037524868 8:19714928-19714950 AGACACTGGGGCCCACTTGAGGG - Intronic
1037541394 8:19875324-19875346 AGACACCGGGGCCTACGTGAGGG - Intergenic
1038854332 8:31314681-31314703 AGACACTGGGGCCTACTTGAGGG + Intergenic
1038920864 8:32082377-32082399 AGACACTGGGGCCTACTTGAGGG - Intronic
1038949705 8:32401123-32401145 AGACACTGGGGCCTACTTGAGGG + Intronic
1039168802 8:34717061-34717083 AGACACCAAGGCCCACTTGAAGG - Intergenic
1039443862 8:37614589-37614611 AGACACCTGGGCCCACTTGAGGG - Intergenic
1039638307 8:39190925-39190947 AGACACTGGGTCCTACTTGAGGG - Intronic
1040357091 8:46629230-46629252 AGACACCGGGAACTACTTGAGGG + Intergenic
1040407609 8:47121789-47121811 AGACACCAGGGCCTACTTGAGGG + Intergenic
1040590049 8:48783141-48783163 AGACACAGGCACCACATTGATGG - Intergenic
1040706576 8:50135912-50135934 AGACAGTGGGACCTACTTGAGGG - Intronic
1040986436 8:53298839-53298861 AGACACTGGGGCCCACTTGAGGG - Intergenic
1041065342 8:54077323-54077345 AGACACTGGGGCCTACTTGATGG + Intronic
1041162186 8:55056611-55056633 AGACACTGGGGCCTGCTTGAGGG + Intergenic
1041221397 8:55655167-55655189 AGACACTGGGGCCTGCTTGAGGG - Intergenic
1041357009 8:57012053-57012075 AGACACTGGGCCCACCTTAAGGG - Intergenic
1041586130 8:59522065-59522087 AGACACTGAGGCCTCCTTGAGGG + Intergenic
1041611879 8:59860013-59860035 AGACACTGGGATCTACTTGAGGG + Intergenic
1041655349 8:60344398-60344420 AGACACTGAGGCCTCCTTGAGGG + Intergenic
1041715763 8:60930642-60930664 AGACACCAGGGCCTACTTGAGGG - Intergenic
1041791870 8:61705226-61705248 AGACACTGGGGCCTACTTGAGGG + Intronic
1041895002 8:62914325-62914347 AGACACTGGGGCCTACTTGAGGG + Intronic
1041914042 8:63121701-63121723 AGACATTGGGGCCTCCTTGAGGG - Intergenic
1042629175 8:70797713-70797735 AGACACCAGGGCCTCATTGAGGG - Intergenic
1043337083 8:79189450-79189472 AGACACTGGGGCCTGCTTGAGGG + Intergenic
1043493856 8:80778837-80778859 AGACACTGGGGCCTACTTGAGGG + Intronic
1043569441 8:81586003-81586025 AGACACCAGGGCCTACTTGAGGG - Intergenic
1043587155 8:81782596-81782618 AGACACCAGGGCCTACTTGAAGG - Intergenic
1043738610 8:83777755-83777777 AGACACTGTGACCTACTTGAGGG + Intergenic
1043778202 8:84297216-84297238 AGACACCAGGGCCTACTTGAGGG - Intronic
1043915776 8:85920678-85920700 AGACACTGGGTCCTACTTGAGGG + Intergenic
1043989690 8:86737744-86737766 AGACACCAGGATCTACTTGAGGG - Intronic
1044067732 8:87719516-87719538 AGACATCGGGGCCTCCTAGAGGG + Intergenic
1044170579 8:89046752-89046774 AGACACTGGGGCCTACTTGAGGG - Intergenic
1044662884 8:94608812-94608834 AGACACTAGGACCTCCTTGAGGG + Intergenic
1045239433 8:100386233-100386255 AGACTCCGGGATTTCCTTGAGGG + Intronic
1045636888 8:104201140-104201162 AGACACCAGGGCCTACTTGAGGG - Intronic
1046810721 8:118530379-118530401 AGACACTGGGGCCGACTTGAGGG - Intronic
1046979742 8:120324052-120324074 GGACACTGGGACCTACTTGAGGG + Intronic
1047033458 8:120909769-120909791 AGACACCAAGACCTACTTGATGG + Intergenic
1047099260 8:121658072-121658094 AGACACTGGGGCCCACCTGAGGG - Intergenic
1047548399 8:125842397-125842419 AGACACCAGGGCCTACTTGAGGG + Intergenic
1047595022 8:126369670-126369692 AGACACTGGGATCTTCTTGAGGG - Intergenic
1047790121 8:128194908-128194930 AGACACCGGGGCATACTTGAGGG + Intergenic
1047862985 8:128989409-128989431 AGACACTGGGGACTCCTTGAAGG - Intergenic
1048153246 8:131914818-131914840 GGACACTGGGGCCCACTTGAGGG - Intronic
1048658085 8:136565035-136565057 AGACACTAGGACCTACTTGAGGG - Intergenic
1049115771 8:140686220-140686242 AGACTCCGGGGCCCACTTGAGGG + Intronic
1050041406 9:1497784-1497806 AGACACCAGGACCTACTGGAGGG - Intergenic
1050070773 9:1811050-1811072 AGACACTGGGGCCAACTTGAGGG + Intergenic
1050127484 9:2374033-2374055 AGACATTGGGACCTACTTGAAGG + Intergenic
1050672167 9:8009840-8009862 AGACACCGGGGCCTACTTGAGGG + Intergenic
1051267858 9:15326091-15326113 AGACACCAGGGCCTACTTGAGGG + Intergenic
1051472815 9:17468221-17468243 AGACATCGGGGCCTACTTGAGGG + Intronic
1051833087 9:21302712-21302734 AGACACAGGGGCCTACTTGAAGG + Intergenic
1051861772 9:21633410-21633432 AGACTCCGGGGCCTACTTGAGGG + Intergenic
1051884442 9:21875562-21875584 AGACACTGGGGCCAACTTGAGGG - Intronic
1051930827 9:22383372-22383394 AGACACCAGGGCCTACTTGAGGG + Intergenic
1051976584 9:22957518-22957540 AGACACCAGGGCCTACTTGAGGG - Intergenic
1052263531 9:26545733-26545755 AGCCACTGGGACCTACTTGAGGG + Intergenic
1052455020 9:28684991-28685013 AGACACTGGGGCCTACTTGAGGG - Intergenic
1052497231 9:29242804-29242826 AGACACTGGGAATCCCTAGATGG + Intergenic
1052658937 9:31403096-31403118 AGACACTGGGGCCTACTTGAGGG + Intergenic
1054932468 9:70650138-70650160 AGACACCAGGACTTACTTGAGGG + Intronic
1055015929 9:71618184-71618206 AGACACCAGGGCCTACTTGAGGG + Intergenic
1055367422 9:75559623-75559645 AGACACCAGGGCCTGCTTGAGGG - Intergenic
1055369881 9:75586206-75586228 AGACACCAGGGCCTCCCTGAGGG + Intergenic
1055990992 9:82105358-82105380 AGACACCAGGGCCTACTTGAGGG - Intergenic
1056436841 9:86582894-86582916 AGACACTGGGTCCCACTGGAGGG + Intergenic
1056750068 9:89343504-89343526 AGACACTGGGGCCTACTTGAGGG - Intronic
1056776547 9:89516997-89517019 AGACACTGGGACCTATTTGAGGG - Intergenic
1057408034 9:94791321-94791343 AGACACCAGGGCCTGCTTGAGGG + Intronic
1057695418 9:97319495-97319517 AGACACTGGGGCCTACTTGAGGG - Intronic
1058831356 9:108820199-108820221 AGACACCAGGGCCTACTTGAGGG + Intergenic
1059363420 9:113766258-113766280 AGACACTGGGACCTACTTAAGGG + Intergenic
1059491989 9:114675706-114675728 AGACTTGGGGACCCCCTTGGTGG - Intergenic
1059931573 9:119265896-119265918 AGACTCTGGGACCCACTTGAAGG - Intronic
1059978245 9:119741001-119741023 AGATACCGGGGCCTACTTGAAGG - Intergenic
1060008418 9:120021112-120021134 AGACACTGGTACCTACTTGAAGG - Intergenic
1060122018 9:121000840-121000862 AGACACCAGGGCCTGCTTGAGGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1062008407 9:134253169-134253191 AGACTCCAGGAACCACTTGAGGG - Intergenic
1062299167 9:135854930-135854952 AGACACTGGGGTCTCCTTGAGGG - Intronic
1185457852 X:319576-319598 AGACATGGGGACCCCCTGGGTGG - Intergenic
1185775415 X:2799251-2799273 AGACACCAGGGCCTACTTGAGGG - Intronic
1185843951 X:3419547-3419569 AGACACCGGGGTCTGCTTGAAGG - Intergenic
1185965017 X:4590524-4590546 AGACACCGGGGCCTACTGGAGGG + Intergenic
1186018484 X:5226616-5226638 AGACACCAGGACCTACCTGAGGG + Intergenic
1186157060 X:6736833-6736855 AGACACTGGGGCCTACTTGAGGG + Intergenic
1186330266 X:8525036-8525058 AGATACTGGGACCTACTTGAGGG - Intergenic
1186373288 X:8968621-8968643 AGACACCAGGACCTACCTGAGGG + Intergenic
1186632392 X:11364184-11364206 AGACACCAGGGCCTACTTGAGGG + Intronic
1186713272 X:12223432-12223454 AGACACCGGGGCCTCCTTGAGGG + Intronic
1186862581 X:13688436-13688458 AGACACCAGGGCCCACTTGAGGG - Intergenic
1186890709 X:13956760-13956782 AGACACTGGGGCCTACTTGAGGG + Intergenic
1186947395 X:14584031-14584053 AGACACTGGGACCTACTTGAGGG + Intronic
1187030659 X:15484862-15484884 AGAGACCGGGTTCCTCTTGATGG + Intronic
1187054295 X:15727350-15727372 AGACACTGGGGCCTACTTGAGGG - Intronic
1187132447 X:16515949-16515971 AGACACTGGGGCCTACTTGAGGG + Intergenic
1187217823 X:17294239-17294261 AGACACCAGGTCCTACTTGAGGG + Intergenic
1187586790 X:20671771-20671793 AGACACTGGGGCCTACTTGAGGG - Intergenic
1187607335 X:20899931-20899953 AGACACCGGGGCCTAGTTGAGGG - Intergenic
1187793502 X:22976935-22976957 AGACACAGGAACCTACTTGAGGG + Intergenic
1188029685 X:25250525-25250547 AGACACCGGGGCCTACATGAGGG - Intergenic
1188072080 X:25729465-25729487 AGACACTGGGGCCTACTTGAGGG + Intergenic
1188090606 X:25960054-25960076 AGACACTGGGGCCTACTTGAAGG - Intergenic
1188147096 X:26627665-26627687 AGACACCAGGGCCTCCCTGAGGG - Intergenic
1188172576 X:26945984-26946006 AGACACCAGGGCCTACTTGAGGG - Intergenic
1188451341 X:30310345-30310367 AGACACTGGAACCTACTTGAAGG - Intergenic
1188471012 X:30539263-30539285 AGACACTGGGACCTACTTGAGGG + Intergenic
1188755992 X:33964351-33964373 AGACACTGGGACCTACATGAGGG - Intergenic
1188770937 X:34153531-34153553 AAACACTGGGACCTACTTGAAGG - Intergenic
1188775787 X:34216703-34216725 AGACACTGGGGCCTACTTGAGGG + Intergenic
1188806436 X:34596299-34596321 AGACACTGGGGCCTACTTGAGGG - Intergenic
1188828935 X:34872541-34872563 AGACACCAGGGCCTACTTGAGGG + Intergenic
1188942640 X:36259873-36259895 AGACACTGGGAACTGCTTGAGGG - Intronic
1188966553 X:36560711-36560733 AGACACCGGGGCCTACTTTATGG - Intergenic
1189050132 X:37635968-37635990 AGACACTGGGGCCTACTTGAGGG - Intronic
1189095668 X:38136401-38136423 AGACACCAGGGCCTACTTGAGGG - Intronic
1189106957 X:38246516-38246538 AGATACAGGGACCTCCTTGAGGG + Intronic
1189444544 X:41068255-41068277 AGACACCAGGCCCTGCTTGAAGG - Intergenic
1189532861 X:41904751-41904773 AGACACTGGGGCCTACTTGAGGG - Intronic
1189584157 X:42440683-42440705 AGACACTGGGGACTCCTTGAGGG + Intergenic
1189596198 X:42568288-42568310 AGACACTGGGGCCAACTTGAGGG - Intergenic
1189611228 X:42738335-42738357 AGACACCAGGGCCTACTTGAGGG + Intergenic
1189638743 X:43043931-43043953 AGACAGTGGGGCCTCCTTGAGGG - Intergenic
1189720661 X:43912930-43912952 AGACACTGGGGCCTACTTGAGGG - Intergenic
1190159295 X:48018741-48018763 AGACACTGGGGCCTACTTGAAGG + Intronic
1190175008 X:48140970-48140992 AGACACTGGGGCCTACTTGAAGG + Intergenic
1190489051 X:50962877-50962899 AGACACTGGGGCCTACTTGAGGG + Intergenic
1190532100 X:51388906-51388928 AGACACTGGGCCCTACTTGAGGG + Intergenic
1190910962 X:54772329-54772351 AGACACTGGGGCCTACTTGAGGG + Intronic
1191046234 X:56140584-56140606 AGACACCAGGGCCTACTTGAGGG + Intergenic
1191061555 X:56303017-56303039 AGACACTGGGGCCTACTTGAGGG - Intergenic
1191088111 X:56590843-56590865 AGACACCAGGGCCCATTTGAGGG - Intergenic
1191130754 X:57007229-57007251 AGACACCAGGACCTACTTAAGGG - Intergenic
1191219290 X:57969690-57969712 AGACACCAGGACCTACTTGAGGG - Intergenic
1191710682 X:64147446-64147468 AGACACTGGGACCTACTTGAGGG - Intergenic
1192024995 X:67440476-67440498 AGACACCAGGGCCTACTTGAGGG - Intergenic
1192056178 X:67776145-67776167 AGACACTGGGGCCTACTTGAGGG + Intergenic
1192418190 X:71003492-71003514 AGACACTGGGGCCTACTTGAGGG - Intergenic
1192690632 X:73359299-73359321 AGACACTGGGGCCTCCTTGAGGG - Intergenic
1192767179 X:74152656-74152678 AGACACAGGTGCCTCCTTGAGGG + Intergenic
1193165965 X:78280744-78280766 AGACACTGGGACCTACCTGAGGG - Intronic
1193263971 X:79445759-79445781 AGACACTGGGACCTACTTGAAGG + Intergenic
1193359633 X:80565454-80565476 AGACACTGGGGCCTACTTGAGGG - Intergenic
1193397165 X:80999244-80999266 AGACACTGGGGCCTACTTGAGGG + Intergenic
1193402228 X:81058985-81059007 AGACACTGGGGCCTACTTGAAGG - Intergenic
1193405788 X:81100193-81100215 AGACACTGGGACCTACTTGAGGG - Intergenic
1193428761 X:81373956-81373978 AGACACTGGGGCCCACTTGAGGG - Intergenic
1193440031 X:81528936-81528958 AGACACTGGGGCCTACTTGATGG - Intergenic
1193515454 X:82456430-82456452 AGACACCAGGACCTACCTGAGGG + Intergenic
1193518176 X:82496057-82496079 AGACACCAGGGCCTACTTGAGGG - Intergenic
1193552767 X:82918651-82918673 AGACACCAGGGCCTACTTGATGG - Intergenic
1193609564 X:83612920-83612942 AGACACTGGGGCCTACTTGAGGG - Intergenic
1193718803 X:84964228-84964250 AGACACTAGGACCTACTTGAGGG + Intergenic
1193722199 X:85000288-85000310 AGACATTGGGGCCCACTTGAGGG - Intergenic
1193722316 X:85001697-85001719 AGACACTGGGGCCTACTTGACGG + Intergenic
1193732899 X:85122819-85122841 AGACACTGGGGCCTACTTGAGGG - Intergenic
1193812942 X:86073084-86073106 AGACACTGGGGCCTACTTGATGG - Intergenic
1193851735 X:86545383-86545405 AGACACCAGGGCCTACTTGAGGG + Intronic
1193867001 X:86745425-86745447 AGACACTGGGGCCTACTTGAGGG - Intronic
1193913279 X:87331625-87331647 AGACACCGGGGCCTACTTCAGGG + Intergenic
1194126669 X:90026731-90026753 AGACACTGGGGCCTACTTGAGGG + Intergenic
1194129823 X:90067666-90067688 AGACACCAGGGCCTACTTGAGGG - Intergenic
1194167428 X:90536265-90536287 AGATACCGGGGCCTACTTGAGGG + Intergenic
1194234425 X:91364686-91364708 AGACACCAGGGCCTACTTGAGGG + Intergenic
1194257906 X:91656889-91656911 AGAAACTGGGGCCTCCTTGAGGG - Intergenic
1194325037 X:92504272-92504294 AGACACCAGGACCTACTTAAGGG - Intronic
1194410206 X:93548065-93548087 AGGCACCGGGGCCTACTTGAGGG + Intergenic
1194415837 X:93610612-93610634 AGACACTGGGGCCTACTTGAGGG + Intergenic
1194425605 X:93733662-93733684 AGACACTGGGGCCTACTTGAGGG - Intergenic
1194435287 X:93861731-93861753 AGACACTGGGGCCTACTTGAGGG + Intergenic
1194912567 X:99664837-99664859 AGACACAGGGGCCTACTTGAGGG - Intergenic
1195155690 X:102121725-102121747 AGACACCAGGGCCTACTTGAAGG + Intergenic
1195280249 X:103326524-103326546 AGACACCAGGGCCTACTTGAGGG + Intergenic
1195448496 X:104981293-104981315 AGACACCAGGGCCTACTTGAGGG - Intronic
1195448550 X:104981970-104981992 AGACACTGGGGCCTACTTGAGGG + Intronic
1195549181 X:106147005-106147027 AGACACCGGGACCTACCAGAAGG + Intergenic
1195602265 X:106762853-106762875 GGACACCGGGGCCTACTTGAGGG + Intronic
1195854927 X:109320691-109320713 AGACACTGGGGCCTCCCTGAGGG - Intergenic
1196010559 X:110882992-110883014 AGACCCCAGGACCTTCTTGAAGG - Intergenic
1196486746 X:116219351-116219373 AGACACCAGGACCTCTTTGAGGG + Intergenic
1196587808 X:117449883-117449905 AGACTCCAGGACCTACTTGATGG + Intergenic
1197045488 X:121992265-121992287 AGACACTGGGGCCTACTTGAGGG + Intergenic
1197107794 X:122736415-122736437 AGACACCAGGGCCTACTTGAGGG + Intergenic
1197177017 X:123496745-123496767 AGACACTGGGTCCTACTTGAGGG - Intergenic
1197242600 X:124135914-124135936 AGACACTGGGGCCTACTTGAGGG - Intronic
1197293784 X:124692266-124692288 AGACACCGGGACCAACTTGAGGG + Intronic
1197366963 X:125575088-125575110 AGACACCAGGACCTACTTGAGGG + Intergenic
1197367239 X:125579164-125579186 AGACACCAGGACCTACTTGAGGG - Intergenic
1197913178 X:131507567-131507589 AGACACCAGGGCCTACTTGAGGG - Intergenic
1197926156 X:131648535-131648557 AGACACTGGGGCCTACTTGAGGG - Intergenic
1197950065 X:131885055-131885077 AGACACCAGGGCCTCCTTGGGGG - Intergenic
1198054478 X:132980401-132980423 AGACACCAGGGCCTACTTGAGGG + Intergenic
1198063202 X:133068233-133068255 AGACACCAGGGCCTACTTGAGGG + Intronic
1198068440 X:133123375-133123397 AGACACCTGGGCCTTCTTGAGGG - Intergenic
1198426896 X:136529632-136529654 AGACACCGGGACCTACTTGAAGG + Intergenic
1198528116 X:137522505-137522527 AGACACCAGGGCCTACTTGAGGG - Intergenic
1198778748 X:140210691-140210713 AGACACCAGGGCCTACTTGAGGG + Intergenic
1198842224 X:140870054-140870076 AGACACTGGGGCCTACTTGAGGG + Intergenic
1198945466 X:142008172-142008194 AGACACCAGGGCCTACTTGAGGG - Intergenic
1199197978 X:145054647-145054669 AGACACCAGGGCCTACTTGAGGG + Intergenic
1199310687 X:146316459-146316481 ACACACTGGGACCTACTTGAGGG + Intergenic
1199718017 X:150520382-150520404 AGACACTGGGGCCTACTTGAGGG + Intergenic
1199877006 X:151940788-151940810 AGACACCAGGACCTGCTTGAGGG - Intergenic
1200483467 Y:3737098-3737120 AGACACCGGGGTCTACTTGAGGG + Intergenic
1200513691 Y:4114043-4114065 AGATACCGGGGCCTACTTGAGGG + Intergenic
1200633769 Y:5623452-5623474 AGACACCAGGACCTACTTAAGGG - Intronic
1201294498 Y:12452148-12452170 AGACACCAGGGCCTACTTGAAGG + Intergenic
1201399480 Y:13589211-13589233 AGACACTGGCACCTACTTGAGGG + Intergenic
1201432919 Y:13923541-13923563 AGATACTGGGACCTACTTGAGGG + Intergenic
1201513035 Y:14786514-14786536 ACACACTGAGACCTCCTTGAGGG - Intronic
1201712694 Y:17009949-17009971 AGACACTGGGACCCACAAGAGGG - Intergenic