ID: 1110421331

View in Genome Browser
Species Human (GRCh38)
Location 13:75312886-75312908
Sequence CTTTCAACAGTGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110421331_1110421335 18 Left 1110421331 13:75312886-75312908 CCCTTCTCCATCACTGTTGAAAG 0: 1
1: 0
2: 1
3: 18
4: 255
Right 1110421335 13:75312927-75312949 ATAAGGAGAGCTGCACATCATGG 0: 1
1: 0
2: 0
3: 12
4: 179
1110421331_1110421334 1 Left 1110421331 13:75312886-75312908 CCCTTCTCCATCACTGTTGAAAG 0: 1
1: 0
2: 1
3: 18
4: 255
Right 1110421334 13:75312910-75312932 AAATAAACATATCACTTATAAGG 0: 1
1: 0
2: 5
3: 72
4: 597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110421331 Original CRISPR CTTTCAACAGTGATGGAGAA GGG (reversed) Exonic
901575563 1:10198093-10198115 CAGTCAACAGTGGTGGAGACAGG - Intergenic
901913772 1:12481650-12481672 CTTTCAAGGGGGATGGGGAAAGG + Intronic
902667368 1:17948889-17948911 CATTCATCAGTGATGCAGGAAGG + Intergenic
906712728 1:47943380-47943402 CTTTCAGCCTTCATGGAGAAAGG + Intronic
908552359 1:65222151-65222173 GTTTACACAGTGCTGGAGAAAGG + Intronic
908662637 1:66453473-66453495 CTGTCAAAACTGATTGAGAATGG + Intergenic
909891067 1:81007464-81007486 AGTTACACAGTGATGGAGAAGGG - Intergenic
910285492 1:85549669-85549691 CTTCCATCAGTGATGAAGAAAGG + Intronic
910556174 1:88535933-88535955 CTTTCATCTGTCATAGAGAATGG - Intergenic
910997178 1:93118527-93118549 GTTTCAACAGTGATTTGGAAAGG + Intronic
912048878 1:105497584-105497606 CCTTAAACAATCATGGAGAAAGG + Intergenic
912220276 1:107666125-107666147 CTTTCTACAGTGAAGAGGAAGGG - Intronic
913084541 1:115424616-115424638 CTTTCAACAGTGACTGAGCAAGG - Intergenic
913111908 1:115664528-115664550 CTCCCAAAAATGATGGAGAAAGG + Intronic
914389526 1:147207267-147207289 CTATCTACAGAGATGGGGAAAGG + Intronic
916806739 1:168267344-168267366 CTTTAAACAGTGATGGCTCAGGG + Intergenic
916914778 1:169393947-169393969 CATACAAGTGTGATGGAGAATGG - Intronic
917069426 1:171133942-171133964 TTTTCATCAGTGTTTGAGAAAGG - Intergenic
918350143 1:183646758-183646780 CTTTCAGCTGGGATGGAGAAGGG + Exonic
919065701 1:192690386-192690408 CTTTCTAAATTGATTGAGAACGG + Intergenic
919429890 1:197479456-197479478 CTATCAAAAGAGATGGAGAGGGG - Intergenic
919618859 1:199841954-199841976 TTTTCACCAGTGATGGAGGACGG - Intergenic
921292592 1:213672289-213672311 CTTTCAAGAGTGGATGAGAAAGG - Intergenic
921574095 1:216814055-216814077 CTTTCAGCAGTAATGCAAAATGG - Intronic
923059184 1:230454948-230454970 CTTTCAAAGGAGATGGAAAAAGG - Intergenic
923413335 1:233731290-233731312 CTTTTAAGGGTGAGGGAGAATGG + Intergenic
923518884 1:234720838-234720860 ACCTCAACAGTGATGGACAAGGG + Intergenic
924294981 1:242577470-242577492 GTTTCAACCCTGAAGGAGAAAGG - Intergenic
1063119281 10:3093247-3093269 CTTTCAACACTGTTGGGGGAAGG - Intronic
1064417068 10:15159131-15159153 CAGTCCACTGTGATGGAGAAGGG - Intronic
1065953410 10:30673010-30673032 CCTTCCAAAGTGATGGAGAAGGG - Intergenic
1066501580 10:36000304-36000326 CAGTCAACAAGGATGGAGAAAGG - Intergenic
1067041700 10:42956638-42956660 CTTTCAACAGGGATCTAGCAGGG - Intergenic
1069802668 10:71091752-71091774 TCTTCAAAAGTGATTGAGAAGGG + Intergenic
1072370480 10:94761670-94761692 CCCTCTGCAGTGATGGAGAAGGG + Intronic
1072386674 10:94937685-94937707 ACTTCTGCAGTGATGGAGAAGGG + Intergenic
1075026264 10:118985820-118985842 CCTTCAAAAGTTAAGGAGAAAGG + Intergenic
1075068058 10:119302948-119302970 CTTCCTTCAGGGATGGAGAAGGG - Intronic
1075627184 10:123972149-123972171 TTGTCAACGGTGATGCAGAAGGG + Intergenic
1078351574 11:10599449-10599471 CTTCCAACACTGACGGAAAATGG + Intronic
1079925292 11:26485449-26485471 ATCTTAACAGTCATGGAGAATGG - Intronic
1080901147 11:36492791-36492813 CTTTCAAAAGTTATAGAGAAAGG + Intronic
1080964924 11:37203159-37203181 CTGCCAACAGTGATGCTGAATGG - Intergenic
1081150084 11:39617531-39617553 TTTTCCACAGTTCTGGAGAATGG + Intergenic
1083290593 11:61687953-61687975 CTTTGAACAGTGAGGGAGACAGG - Intronic
1083824367 11:65190066-65190088 CTTTCAGAGGTGAGGGAGAATGG - Intronic
1085217896 11:74848456-74848478 TTTTCACCTGTCATGGAGAAGGG + Exonic
1089458892 11:118641330-118641352 TGTTCGACAGTGAGGGAGAAGGG + Intronic
1089663473 11:120001257-120001279 CTTTTAACAGTCCAGGAGAAGGG + Intergenic
1089883236 11:121794978-121795000 CCTTGAACAGTCATGGAGGAAGG - Intergenic
1091554524 12:1562449-1562471 CTTTCTACAGTGCTGCAGGATGG + Intronic
1092038840 12:5365325-5365347 ATTTGAGTAGTGATGGAGAAAGG + Intergenic
1092990216 12:13890166-13890188 GTTTCAACACAGATGAAGAATGG + Intronic
1094354349 12:29562337-29562359 CCTCCAACAGTGATGCAGAAGGG + Intronic
1094444132 12:30511019-30511041 CTATCAACATTCATGGAAAAAGG + Intergenic
1095499958 12:42827224-42827246 CCTTCCACAGTGATGATGAAAGG + Intergenic
1097307113 12:58081512-58081534 CTTTCCACTGTGAAGTAGAAGGG - Intergenic
1097670690 12:62533918-62533940 GTTCCAACACTGTTGGAGAAGGG - Intronic
1097967003 12:65591987-65592009 CTTTCTGCAGTGAAGGAGAAGGG + Intergenic
1098237957 12:68436254-68436276 CTCTTAGCAGTGATGGAGACTGG + Intergenic
1100312009 12:93404645-93404667 CTTTCAATAGTGATTGAAAAAGG + Exonic
1101728568 12:107407915-107407937 CGTTGTACAGTGATGGAGGATGG + Intronic
1102906049 12:116675932-116675954 CTGGCAAGAGTGATGGAGAGAGG + Intergenic
1104216244 12:126736524-126736546 CTCTCTACAATGATGGAGAATGG - Intergenic
1105518007 13:21107806-21107828 CCATCAACAAGGATGGAGAAAGG - Intergenic
1107461809 13:40611534-40611556 CTTGAAACAGTGATGCAGAGGGG + Intronic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1108735136 13:53275700-53275722 CTTTTAACAGTTATGGAGGCTGG - Intergenic
1110421331 13:75312886-75312908 CTTTCAACAGTGATGGAGAAGGG - Exonic
1110925025 13:81140271-81140293 CTTTTTACAGTGATGATGAAGGG + Intergenic
1110964017 13:81668386-81668408 CTTCCAACAGGGATAGAGAAAGG + Intergenic
1112199673 13:97262410-97262432 AATGCAACAGTGAGGGAGAAAGG - Intronic
1112260674 13:97875261-97875283 CTTTGAAGGGTGAGGGAGAATGG + Intergenic
1112996119 13:105576974-105576996 GTTTTGACAGTGATGGGGAAGGG - Intergenic
1113362359 13:109643238-109643260 CTTTCATCAGTGAATGAGGAAGG - Intergenic
1118012754 14:61626678-61626700 CTTTCACGATGGATGGAGAATGG - Intronic
1118493823 14:66288209-66288231 CTTTCAACACAGATGCAAAAGGG - Intergenic
1119772359 14:77228190-77228212 CTTACAAGAAAGATGGAGAAAGG + Intronic
1120163957 14:81174334-81174356 CTTTCAGCAGGGATGTACAAGGG - Intergenic
1122201837 14:100127561-100127583 GTTCCAAGAGTGATGGGGAAGGG - Intronic
1125438854 15:39679180-39679202 CTTTTAAGAAAGATGGAGAATGG + Intronic
1125482716 15:40091559-40091581 CCTTCAACAGTGTTTGACAAAGG + Exonic
1125804719 15:42483591-42483613 CTTTTAATAGTGAGGGACAAAGG - Intronic
1126474149 15:49048384-49048406 CTTTCAATTGTGAAGGAGGACGG - Intergenic
1127744724 15:61955577-61955599 TTTGGAACAGTGATGGAGTAAGG - Intronic
1128114186 15:65095062-65095084 CCTGCACCAGTGCTGGAGAAGGG + Intronic
1128679095 15:69634308-69634330 CTTGCAACAGGTATGGCGAAAGG + Intergenic
1129706487 15:77797555-77797577 GCTTCAACCGTGATGGTGAAAGG + Intronic
1130012342 15:80161404-80161426 CTAGCAACAGTCATGGTGAAGGG - Intronic
1130858062 15:87859097-87859119 AGTTCAACAGAGATGTAGAAAGG - Intergenic
1131808233 15:96145657-96145679 CCTTGAACAGTGAAGGTGAAAGG - Intergenic
1131866621 15:96717969-96717991 TGTTCAGAAGTGATGGAGAAGGG - Intergenic
1131909649 15:97183616-97183638 ATTTTAACAGTGATGGAAATGGG - Intergenic
1132137760 15:99360171-99360193 GTTTCAACAGTGCTGGAAACAGG - Intronic
1133503510 16:6387904-6387926 CTTTCAACAGTCATAGTGACTGG - Intronic
1133633014 16:7639745-7639767 CTGTCTACAGTGTTGAAGAATGG - Intronic
1133818951 16:9219517-9219539 TTTTCCAGAGTGAAGGAGAAAGG + Intergenic
1137571576 16:49569587-49569609 GTTGCAACAGCCATGGAGAATGG + Intronic
1137594931 16:49717169-49717191 GTATCAACATTAATGGAGAAAGG + Intronic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1138478967 16:57289109-57289131 CCTACCACAATGATGGAGAAGGG + Intergenic
1139053555 16:63154481-63154503 GTTCCACCAGTTATGGAGAAAGG - Intergenic
1140637773 16:76936466-76936488 CTTTCCAGAGTTATTGAGAATGG + Intergenic
1142311272 16:89315414-89315436 CCTTCAGCAGTGAGGCAGAAAGG - Intronic
1142912481 17:3107082-3107104 ATTTCCACTGTGATGGAGCAGGG - Intergenic
1143510145 17:7390796-7390818 CTGTCATCAGGGAGGGAGAAAGG + Intronic
1143709449 17:8724262-8724284 CCTACCACACTGATGGAGAAAGG - Intergenic
1144652672 17:17017293-17017315 CCCTCAACAGTGATTCAGAAAGG - Intergenic
1146411161 17:32586796-32586818 CTTTGAGCAGTCATGGAGAGTGG - Intronic
1146539368 17:33681107-33681129 CATTCAACTGGGAAGGAGAAAGG - Intronic
1152819958 17:82432472-82432494 GTTTCCACAGTGAGGGGGAAGGG + Intronic
1153378251 18:4406253-4406275 TTTTCATCTGTGATGCAGAAAGG + Intronic
1153545983 18:6205222-6205244 CTTTGAATATGGATGGAGAAAGG + Intronic
1154405754 18:14089785-14089807 CATTAAACAGTAATGGAGATAGG + Intronic
1156786029 18:40916435-40916457 TTTTCAACAGAGATTGAGAAGGG + Intergenic
1157807190 18:50666832-50666854 CTTCCCACAGTGATGATGAAAGG + Intronic
1158275466 18:55762252-55762274 CTTTGAAAAATAATGGAGAAGGG - Intergenic
1160183315 18:76654897-76654919 CCTTCAACAGTGGTGGCCAAGGG + Intergenic
1163988667 19:20977053-20977075 ATTTCAGCAATGATGTAGAAAGG + Intergenic
1166214323 19:41325612-41325634 CTGAGAACAGAGATGGAGAATGG - Intronic
1168697536 19:58412996-58413018 CTTTGAACAGGAATGGAAAAAGG - Intronic
925449867 2:3959973-3959995 CTTTCACCAGAGAGTGAGAACGG - Intergenic
925475987 2:4215616-4215638 ATCTCAACAATAATGGAGAAAGG - Intergenic
925544299 2:5001763-5001785 CTGTTAAGAGTGAAGGAGAAGGG - Intergenic
925864463 2:8214346-8214368 CTCTGAACAGTGATTCAGAATGG + Intergenic
927694963 2:25233332-25233354 GTTTCACCAAGGATGGAGAAAGG - Exonic
927825696 2:26308667-26308689 TTTTCAATAGTTATGAAGAAAGG - Intronic
927932328 2:27053038-27053060 CTTTGTCCAGTGATGGGGAAGGG + Exonic
929631086 2:43462743-43462765 CCCTCAACACTGAGGGAGAACGG - Intronic
930295757 2:49551449-49551471 CTTTCAATAATCATGAAGAAAGG - Intergenic
931723436 2:65084456-65084478 CTGTCAATAGTGAAGGAAAAAGG + Exonic
931780587 2:65576247-65576269 CTGACAACAGTGATTGAGATAGG + Intergenic
932456038 2:71850650-71850672 CTGTCCAGAGTGATAGAGAATGG + Intergenic
932746558 2:74338412-74338434 TTTTCAACAGTGAGAGAGGAGGG + Intronic
934865799 2:97809344-97809366 CTTCCAACAGAGATGGAGAAGGG - Intronic
936256582 2:110920175-110920197 TTTTCATCAGTGATGTATAAGGG + Intronic
936554425 2:113481530-113481552 ATTTCAACACTGATGGGGACAGG - Intronic
939400452 2:141685636-141685658 CTTACAACAGGGATGTAGAAAGG + Intronic
939493936 2:142906439-142906461 CTGGCAAGAGTGGTGGAGAACGG + Intronic
940344535 2:152615882-152615904 ATTTTCACAGTGATGGGGAAAGG - Intronic
940808372 2:158213972-158213994 CTTTCAGCAGTGGTGGGGTAGGG + Intronic
941434910 2:165457858-165457880 CTTTCAAAAGTGGCGAAGAAAGG + Intergenic
941708573 2:168687050-168687072 CCTTCAATAGGAATGGAGAAAGG + Intronic
941967046 2:171310936-171310958 CATTCCTCAGTGAAGGAGAAAGG - Intergenic
942993249 2:182228707-182228729 CTTTTACCATAGATGGAGAAAGG - Intronic
943565953 2:189516834-189516856 TGTTGAACAGTGATGGTGAAAGG - Intergenic
946961607 2:224991375-224991397 GTTACAACAGTTATGTAGAAGGG - Intronic
947242803 2:228014709-228014731 CTTCCACCAGGGAAGGAGAAGGG - Intronic
1168937270 20:1676171-1676193 CCTTAAACATAGATGGAGAAGGG - Intergenic
1169735939 20:8837703-8837725 CTTCCCACAGTTATGGTGAAAGG - Intronic
1170499120 20:16956656-16956678 CTTCCAACAGTGAGGAAGCAAGG + Intergenic
1174090204 20:48040570-48040592 TTTTCAATAGTGATGGACCATGG + Intergenic
1174933129 20:54837453-54837475 CTGGCAAGAGTGAAGGAGAATGG + Intergenic
1176294566 21:5064525-5064547 CTTTGAACAGTGATGGCCCAAGG + Intergenic
1176926334 21:14753841-14753863 CCTTCAAGAGGGAAGGAGAAAGG + Intergenic
1178791444 21:35704090-35704112 CTTTGAACAGTCATGAAGTATGG - Intronic
1179228141 21:39474368-39474390 ATTTCAACAGTGTTGCAAAAAGG - Intronic
1179862486 21:44197601-44197623 CTTTGAACAGTGATGGCCCAAGG - Intergenic
1180587666 22:16907206-16907228 CTTACAACAGGGAGGGAGGAAGG + Intergenic
1181943857 22:26499739-26499761 TATTCAACAGAGCTGGAGAAGGG + Intronic
950278325 3:11682618-11682640 CTTTCAATAGCGATGGAAAGTGG + Intronic
950469805 3:13177566-13177588 CTGTCCACAGGGATGGGGAATGG - Intergenic
950958045 3:17076124-17076146 CTTGCAACACTGCTGGGGAAAGG - Intronic
952067852 3:29593533-29593555 CTTTATATAGTGATGGACAAGGG + Intronic
954588178 3:51755111-51755133 CCTTCAAAAGTGAAGGAGAGAGG - Intergenic
954821154 3:53328898-53328920 CTGTAATCAGTGAAGGAGAAAGG - Intronic
955752682 3:62198479-62198501 TTCTCAACAGTCATGGAAAATGG + Intronic
957162642 3:76629966-76629988 ATGTCAAAAGAGATGGAGAAAGG - Intronic
957521455 3:81323762-81323784 CTTTCAACTGTGTTTGAGTAAGG + Intergenic
957933725 3:86915278-86915300 CCCTCAACAGTAATGGACAAGGG + Intergenic
958534956 3:95388322-95388344 CTTTCAACTGTGATGTAGTAAGG + Intergenic
960432872 3:117591154-117591176 CCCTCCACAATGATGGAGAAAGG - Intergenic
961347775 3:126275225-126275247 GTTTCAACAGTGTTGGAAATTGG + Intergenic
961395202 3:126582186-126582208 CTTACAACATAGATGGAAAATGG + Intronic
963800350 3:149669958-149669980 CTGTCAATAGTGAAGGAGGAGGG + Intronic
964045601 3:152321715-152321737 CTTTAAAATTTGATGGAGAAAGG - Intronic
964215513 3:154276110-154276132 ATTTAAACAATGATGAAGAATGG + Exonic
965480049 3:169207123-169207145 CTTTCATCATTGAGGAAGAAAGG + Intronic
965584102 3:170300192-170300214 CCATTAACAGTGATGGAAAAAGG - Intronic
969387353 4:6863198-6863220 CCTTCAATAGTGATGGGGAGTGG + Exonic
973983648 4:56328242-56328264 CTTTCTACAGTAATGGTGAAAGG + Exonic
975192876 4:71486484-71486506 ATTTCAACAGTGTATGAGAAAGG - Intronic
976187975 4:82461960-82461982 CATTCACAAATGATGGAGAAAGG + Intergenic
976400403 4:84600853-84600875 CTTGCAGCAGTGAATGAGAATGG + Intronic
976811796 4:89107157-89107179 CTTTAAACAGTGATGGCTCAGGG - Intronic
977013159 4:91659485-91659507 CTGCTAACAGTGAAGGAGAAGGG + Intergenic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
980738994 4:136927090-136927112 CTTCCATCAGTGAAGGAGAGGGG - Intergenic
981172288 4:141638391-141638413 TTTGCAACAGTGACAGAGAAGGG + Intronic
981679695 4:147382192-147382214 CCGTCTACAGAGATGGAGAAAGG + Intergenic
981939084 4:150262482-150262504 TTTTTAGCAGGGATGGAGAATGG + Intergenic
982802689 4:159723444-159723466 CTTTCAAGCGTGCTGGAGCAAGG + Intergenic
984239444 4:177200011-177200033 CTCTCAAGAGTGCTGGAGCAGGG - Intergenic
985048879 4:185970199-185970221 CTTCCACCAGTGAGGGTGAAGGG + Intergenic
985327950 4:188794511-188794533 TATTCTACAGTGATGGAGCATGG - Intergenic
986747762 5:10759504-10759526 CATTCCACTGTGATGGAAAATGG - Intronic
987868960 5:23587188-23587210 CTTGCAAAAGTGATGGTTAATGG + Intergenic
988381683 5:30504581-30504603 CTTTCAACAGTGATTACGAGGGG + Intergenic
991446377 5:66704433-66704455 CTTTCAACAGAGATGAAGGATGG - Intronic
991609942 5:68439745-68439767 TTTTCCACAGTGATGTAGAGAGG + Intergenic
992172329 5:74115899-74115921 ATATCTACAGTGATGGAAAATGG + Intergenic
993615613 5:90108050-90108072 CATTCAACTGAGATAGAGAAGGG - Intergenic
995986751 5:118185482-118185504 ATTTCAACAGAAATGGAGAGGGG + Intergenic
996363137 5:122672688-122672710 CTCTCAACTGTGCTAGAGAATGG - Intergenic
997755635 5:136396492-136396514 CTTTCTACAATGATAGGGAAAGG - Intronic
997783430 5:136683401-136683423 GTGTCAACAGTGATGCACAATGG - Intergenic
998615084 5:143731194-143731216 CTTTGAACAGTGATATACAAGGG - Intergenic
999551723 5:152694886-152694908 CTTTTAACAAAAATGGAGAAGGG - Intergenic
1001025086 5:168217219-168217241 CCTGCAATAATGATGGAGAAGGG - Intronic
1001239872 5:170060435-170060457 AATTCAACAGAGATGGAGGAGGG - Intronic
1003755068 6:9109386-9109408 ATTTCTACATTGATGTAGAAAGG + Intergenic
1003859626 6:10310468-10310490 CTTTGAAATGTGATGGAAAAAGG - Intergenic
1003898169 6:10627861-10627883 TATTCAACAGAGAGGGAGAAAGG + Exonic
1006101802 6:31690173-31690195 CTTCCCCCAGGGATGGAGAAAGG - Intronic
1008768660 6:54951654-54951676 TTTTCAACAGAGATGTAAAATGG + Intergenic
1010216292 6:73404935-73404957 CTTCCTGCAGTGATGGAAAATGG + Intronic
1010702979 6:79074712-79074734 ATTTCAAGTGTGATTGAGAAAGG - Intronic
1011121476 6:83958479-83958501 CAGTCAAGAGAGATGGAGAAGGG + Intronic
1012432178 6:99175450-99175472 CTGTCATCATTGATGGAGGATGG + Intergenic
1012711590 6:102613715-102613737 TTTTCACCTGTGATGCAGAAAGG - Intergenic
1012758478 6:103264109-103264131 CTTTCACCAGTGAGGGCAAAGGG - Intergenic
1013204319 6:107933064-107933086 CTTTTAACAGGGAGGCAGAAGGG + Intronic
1015005191 6:128271629-128271651 CTTTAAACTTTGATTGAGAAGGG - Intronic
1016511720 6:144850143-144850165 ATTTGAATAGTCATGGAGAATGG + Intronic
1016904328 6:149133875-149133897 CTTTCAACAGAGTTGGTCAAGGG - Intergenic
1017894666 6:158668731-158668753 GTGGCAATAGTGATGGAGAATGG + Intronic
1017983296 6:159421439-159421461 CTTCCACCACCGATGGAGAATGG - Intergenic
1018291025 6:162292748-162292770 CTTTCGGTAGTGATGGAGATGGG + Intronic
1020886416 7:13823780-13823802 CTGTTAACAGTGGGGGAGAATGG - Intergenic
1022195920 7:28067252-28067274 CTCACAACACTGATGGAGCAAGG - Intronic
1023078636 7:36507208-36507230 CTCACAACAGTGCTGGAAAATGG + Intergenic
1023238386 7:38115184-38115206 ATGTAAACAGTGAAGGAGAAGGG - Intergenic
1023344069 7:39253095-39253117 CTTTCCTCTGTGCTGGAGAAGGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1032980907 7:137281536-137281558 CATTCAAAAGTGCTGGAGTAAGG - Intronic
1033803157 7:144924917-144924939 GTTACAAAAGTGATAGAGAAGGG + Intergenic
1033869711 7:145736658-145736680 CTTATAAAAGTGATGAAGAAGGG - Intergenic
1034132061 7:148728220-148728242 CGGACAACACTGATGGAGAAAGG + Intronic
1034634977 7:152560024-152560046 TTTTTAAAAGTGATGGTGAAAGG + Intergenic
1036179612 8:6572959-6572981 CTTTCTTCAGGGAGGGAGAAAGG - Intronic
1038781827 8:30574803-30574825 ATGTGAACAGTGGTGGAGAATGG - Intergenic
1038941082 8:32306700-32306722 CTTTTTCCAGTAATGGAGAAAGG + Intronic
1039935898 8:42044849-42044871 TATTTGACAGTGATGGAGAAAGG - Intronic
1041861675 8:62520989-62521011 CTGTCATCTGAGATGGAGAAGGG - Intronic
1042855133 8:73259467-73259489 CTTTCAACAGTGCTGATGAGAGG + Exonic
1044022890 8:87128570-87128592 TTTTGAACTGTGATGGATAATGG + Intronic
1045132693 8:99174414-99174436 CCTGCAACAGTGATGGAAAAAGG + Intronic
1046582978 8:116115912-116115934 ATTTCACCAGTTATGGGGAACGG - Intergenic
1048197751 8:132346524-132346546 CTTTTAGCTGTGATGGAGAGTGG - Intronic
1049813003 8:144584433-144584455 GTTTCCTCAGTGATGGACAATGG + Intronic
1049898582 9:135655-135677 ATTTCAACACTGATGGGGACAGG + Intronic
1050097943 9:2087048-2087070 CTTTCACCAGTCATGGCAAATGG - Exonic
1050098323 9:2091305-2091327 CTATAGACAGGGATGGAGAACGG - Intronic
1051800193 9:20923948-20923970 CACTTAACTGTGATGGAGAAAGG - Intronic
1053741634 9:41145958-41145980 ATTTCAACACTGATGGGGACAGG + Intronic
1054346846 9:63975440-63975462 ATTTCAACACTGATGGGGACAGG + Intergenic
1054444625 9:65302103-65302125 ATTTCAACACTGATGGGGACAGG + Intergenic
1054485646 9:65719397-65719419 ATTTCAACACTGATGGGGACAGG - Intronic
1054686710 9:68285342-68285364 ATTTCAACACTGATGGGGACAGG - Intronic
1055778321 9:79790822-79790844 CTATCAACAGCCGTGGAGAAAGG + Intergenic
1059038873 9:110790500-110790522 CTTTGAACAGTGAGAGGGAATGG + Intronic
1061379396 9:130244926-130244948 CTTGCGACAGGGCTGGAGAAAGG + Intergenic
1062293209 9:135807177-135807199 CTTTCCACAATGAGAGAGAAAGG + Intergenic
1185835985 X:3346371-3346393 CTTCAAACAGTGCTGGGGAACGG + Intronic
1186178305 X:6948250-6948272 ATTTAAAGAGTGATTGAGAAAGG - Intergenic
1186189901 X:7057885-7057907 TTTTCAAGAGGGAAGGAGAAGGG + Intronic
1186576895 X:10776422-10776444 CTTGCAACGGTGATGAAAAAAGG + Intronic
1187386888 X:18857227-18857249 CTTCCCTCAGTGAGGGAGAAGGG - Intergenic
1187426186 X:19179589-19179611 CTTTCAAGAGTGTTGGTAAATGG - Intergenic
1188115230 X:26234095-26234117 TTTACAACAATGAGGGAGAATGG - Intergenic
1188713216 X:33428166-33428188 CTGTCCCCAGAGATGGAGAATGG - Intergenic
1193364610 X:80616896-80616918 CTTTCATCAGTTCTGGAAAAAGG + Intergenic
1194809633 X:98374879-98374901 CTTTGAAGGGTGAAGGAGAATGG + Intergenic
1197038813 X:121909205-121909227 CTTTGAAGGGTGAGGGAGAATGG - Intergenic
1199869522 X:151885405-151885427 CTTTCAGGACTGATGGAGAGTGG + Intergenic