ID: 1110421658

View in Genome Browser
Species Human (GRCh38)
Location 13:75316748-75316770
Sequence ACTTGGAAACTACACTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110421651_1110421658 13 Left 1110421651 13:75316712-75316734 CCAAATGAAACACTGCATCAAAA 0: 1
1: 0
2: 1
3: 47
4: 477
Right 1110421658 13:75316748-75316770 ACTTGGAAACTACACTGGGATGG 0: 1
1: 0
2: 1
3: 12
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110421658 Original CRISPR ACTTGGAAACTACACTGGGA TGG Intronic
900664410 1:3804986-3805008 ACTTGGCAAGTACACTTGGCAGG - Intergenic
900971744 1:5995744-5995766 ACTTGTAAACAACCCTGTGAGGG + Intronic
908419245 1:63943493-63943515 ACTTGGAGACCACACTGGTGAGG - Intronic
910089265 1:83442744-83442766 CCATGGAAACTACATTGGGATGG - Intergenic
913046097 1:115074651-115074673 ACTTAGAAAATATACTGAGAAGG - Intronic
919861317 1:201740837-201740859 ACTTGGAAACTGCACTTCCAAGG + Intronic
920453517 1:206079461-206079483 TATTGGCAACTACACTGTGATGG - Intronic
1065777361 10:29133194-29133216 TTTTGGAAACAACAGTGGGATGG - Intergenic
1071814515 10:89219323-89219345 ACTGGAAAACTACACTGGGATGG + Intronic
1072790525 10:98314457-98314479 ACTGGAAAACAACACGGGGAGGG + Intergenic
1076305894 10:129465866-129465888 ACAGGGAAACTTCACCGGGAAGG + Intergenic
1078961686 11:16281117-16281139 ACTTGGAAACTTCTTTGGAAGGG - Intronic
1081534157 11:43985200-43985222 TCCTTGAAACCACACTGGGAGGG - Intergenic
1081750954 11:45511017-45511039 ACATGGAAAGTAAAGTGGGAAGG + Intergenic
1082171752 11:49013309-49013331 ACTTGGAAAACATACTGGAATGG - Intergenic
1086694014 11:89822641-89822663 ACTTGGAAAACATACTGGAATGG + Intergenic
1086712132 11:90021928-90021950 ACTTGGAAAACATACTGGAATGG - Intergenic
1091409985 12:233053-233075 ACGTGGAAGACACACTGGGATGG - Intronic
1092266334 12:6983584-6983606 ACTTCCAAACCAAACTGGGATGG - Intronic
1093793241 12:23279767-23279789 ACATGGATAATACGCTGGGAAGG - Intergenic
1099916334 12:88898632-88898654 ATTTGGAAACTATACTGAGCTGG + Intergenic
1100170149 12:91966027-91966049 ACTGGTGAACAACACTGGGAAGG + Intergenic
1100185943 12:92140088-92140110 ACTGGGAAGCTAAACTGAGAAGG - Intronic
1102799586 12:115719797-115719819 ATGTGGAACCTACACAGGGAGGG + Intergenic
1106198536 13:27515507-27515529 ACTTGGAAATTAACCTGGTATGG - Intergenic
1109680103 13:65740236-65740258 ACTTGGAATCTATAGTTGGAAGG - Intergenic
1110421658 13:75316748-75316770 ACTTGGAAACTACACTGGGATGG + Intronic
1116591188 14:46775905-46775927 ACTTCCAGACTGCACTGGGAGGG - Intergenic
1119782765 14:77288794-77288816 TCTTACAAACTCCACTGGGAAGG + Exonic
1120734648 14:88039389-88039411 ACTTGGCCACTTCACTGCGAGGG - Intergenic
1120757433 14:88257345-88257367 ACGTGGAAATGAGACTGGGAAGG - Intronic
1121076907 14:91076630-91076652 TCTGGGAAACTCCACAGGGATGG + Intronic
1122415450 14:101547496-101547518 ACTGGGAAGATTCACTGGGATGG - Intergenic
1123855218 15:24403176-24403198 ACTTGAAAAATTCACTGGCATGG - Intergenic
1124986385 15:34620196-34620218 ACGTGGAAACTAAACTGAAATGG - Intergenic
1128385851 15:67147647-67147669 ACCTGGACACGACACTGGGGCGG - Intronic
1129167462 15:73786883-73786905 ACTGGGAAGCTACACGGGAAAGG - Intergenic
1134563892 16:15234368-15234390 ACTCTGAAACTAGTCTGGGAGGG + Intergenic
1134738602 16:16522324-16522346 ACTCTGAAACTAGTCTGGGAGGG - Intergenic
1134928898 16:18189832-18189854 ACTCTGAAACTAGTCTGGGAGGG + Intergenic
1138082756 16:54107341-54107363 ACTTGGGAATGACACTGAGAAGG + Intronic
1143347980 17:6264056-6264078 ACTGGGAAACTACACGAGGAAGG + Intergenic
1143539919 17:7562645-7562667 ACGTGGAAACTGGACTGGAATGG - Intronic
1145991538 17:29081990-29082012 CCTTGGAATCAAAACTGGGATGG - Intronic
1146313749 17:31791195-31791217 AGTGGAAAGCTACACTGGGATGG - Intergenic
1149884998 17:60330904-60330926 ACTTGGAAACTTGCCTGGAATGG - Intronic
1150010241 17:61496396-61496418 CCTTGGAAACTACCCTGGGGGGG + Intergenic
1151062196 17:71108472-71108494 ACTGGGAAACTGAAGTGGGAGGG - Intergenic
1155653156 18:28164931-28164953 ACTTGGAAACCACAATTGAAGGG - Intronic
1156375361 18:36510466-36510488 ACTTGGAAAAAACACTGGACAGG - Intronic
1157372615 18:47130457-47130479 ACTTCCAAAGTACACTGGGCAGG - Intronic
1159706330 18:71693069-71693091 ACTTGGAAAAAAGAGTGGGAAGG + Intergenic
1161182142 19:2890958-2890980 ACTTTGATACTAAATTGGGACGG - Intergenic
1165158903 19:33804470-33804492 ACTTTGGAGCTCCACTGGGAAGG + Intronic
926285549 2:11484673-11484695 ACTTGGAGCCTAAGCTGGGAGGG + Intergenic
926795352 2:16614720-16614742 AGATGGAAAATACACTGAGACGG + Intronic
930206793 2:48595074-48595096 ACTTGGAAGCTACTGTAGGAGGG + Intronic
931825515 2:65996564-65996586 ACTTTTAAACTACAATGGTAGGG - Intergenic
935278835 2:101500092-101500114 ACTTGGAAATTACTCTGGTAGGG - Intergenic
937931411 2:127208263-127208285 ACCTGGAAGCCACACGGGGAAGG + Intronic
939885296 2:147674945-147674967 ACAGTGAAACTACACTGGAATGG - Intergenic
942308587 2:174632965-174632987 ACTTGGGAACTGCAGTAGGAAGG - Intronic
944415113 2:199472047-199472069 ACTTGGAAAATACAGTGAGAAGG - Intergenic
945170089 2:206986658-206986680 ACTTTGAAACTACACAGACATGG + Intergenic
945784739 2:214218849-214218871 ACTGGTAAATTACACTGGGATGG - Intronic
1171476846 20:25416685-25416707 ATTTGGAAGCTCCACTGGAAGGG + Intronic
1172841553 20:37905215-37905237 AGTTGGAACTTACACTAGGAGGG + Intronic
1175262349 20:57682482-57682504 ACTTTGAAACTCCTCTGGGCCGG - Intronic
1177201143 21:17957476-17957498 ACTAGGAAACCACACAGGGTAGG + Intronic
1178169103 21:30018623-30018645 CCTTAGGAAATACACTGGGAAGG - Intergenic
1179242192 21:39602205-39602227 ACTGGGGAACTTCACCGGGAGGG + Intronic
1181268257 22:21643358-21643380 AATAGGAAACTCCACTGGGGAGG + Intronic
1183844813 22:40533768-40533790 AATTGGTAACTGCACTGAGAAGG - Intronic
949171887 3:1009710-1009732 AATTGAAACCTACACTGGAATGG - Intergenic
951097682 3:18650758-18650780 ACTTGGAATCTAGAAAGGGAAGG - Intergenic
953259482 3:41323674-41323696 ATTTGGACAGGACACTGGGAGGG - Intronic
953437375 3:42889123-42889145 AAAGGGAAAATACACTGGGATGG + Intronic
957202229 3:77150874-77150896 ATTTGGAAACTACAATTGGCAGG + Intronic
959699107 3:109281642-109281664 GAGTTGAAACTACACTGGGAAGG + Intergenic
962110154 3:132436707-132436729 ACTTCGTACCTACACTAGGATGG - Intronic
969883387 4:10194571-10194593 GCTTGGGAATCACACTGGGAAGG + Intergenic
970238946 4:13988182-13988204 GCTTGGAAAAGACACTGGAAGGG - Intergenic
970519336 4:16866262-16866284 ACTTATAAACTACATTGGAAAGG + Intronic
973033102 4:45369704-45369726 ACTTGGAAACTAAAATATGATGG + Intergenic
973754411 4:54060205-54060227 GTTTGGGAACTACACTGGGATGG - Intronic
979197925 4:117942036-117942058 ACTTGAGAACCACACAGGGAAGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979357869 4:119726708-119726730 AATTCCAAAGTACACTGGGAAGG - Intergenic
982617418 4:157657358-157657380 ATTTTAAAATTACACTGGGATGG - Intergenic
983014873 4:162600819-162600841 AGTTGGAAATTACACTGAAATGG - Intergenic
983058303 4:163125572-163125594 AGTGGGAAACTGCAGTGGGAAGG + Intronic
984961045 4:185099288-185099310 AGTTGGAAGGAACACTGGGAAGG - Intergenic
985120229 4:186632906-186632928 TCTTGGAGCTTACACTGGGATGG - Intronic
986903786 5:12468578-12468600 CCTTGGTAACAACACTGTGAGGG - Intergenic
987024458 5:13910276-13910298 ACTGGGAAACTTCACTGTGAGGG - Intronic
988731923 5:33981045-33981067 ACGTGGAAAGTGCAGTGGGAAGG + Intronic
991609975 5:68440013-68440035 ACTGGGCAATTACATTGGGAGGG - Intergenic
992486226 5:77199055-77199077 ACTTAGAAACTCCCCTGGAAAGG - Intergenic
995248165 5:109959222-109959244 ACTTGCAAACCACACTTGGATGG + Intergenic
996632280 5:125648196-125648218 ACTTGGGAAAAAGACTGGGAAGG + Intergenic
996676594 5:126182266-126182288 ACCTGGAAATTTCACTGGAAGGG - Intergenic
998173774 5:139887640-139887662 ACTAGGAAATGACACTAGGAGGG - Intronic
1000244930 5:159441504-159441526 TCTTAGAAACTGCACAGGGAAGG + Intergenic
1000366278 5:160494258-160494280 ACTTGGGGACTCCACAGGGAGGG + Intergenic
1000682505 5:164203427-164203449 ATATGGAAAAAACACTGGGAAGG + Intergenic
1010839814 6:80635664-80635686 ACATGGATACTACACTTGAAGGG - Intergenic
1010850335 6:80767997-80768019 ACTTGGCAGCCTCACTGGGAGGG + Intergenic
1011543552 6:88459699-88459721 ATTTGGAAACTACAGAGAGAAGG - Intergenic
1014231314 6:118905518-118905540 ACTTGGAAATCATACTGGGAAGG - Intronic
1015159246 6:130133585-130133607 ATTTGGAAACTTTACTGGCAGGG - Exonic
1019017453 6:168890245-168890267 GCTTTGAAACTTGACTGGGAGGG + Intergenic
1022479474 7:30733634-30733656 ATTTGGAATCCAGACTGGGAGGG - Intronic
1023779569 7:43643365-43643387 ACTTGGAAAAGCCACTGGGTAGG - Intronic
1023882810 7:44330026-44330048 AGTTGGAAGCTACACAGGGTGGG - Intronic
1025527365 7:61832175-61832197 TCTTAGAAACTACTCTGTGATGG - Intergenic
1027306124 7:76899182-76899204 CCATGGAAACTACATTGGGATGG - Intergenic
1028112261 7:86955733-86955755 ACTTGGAATCTGAATTGGGATGG - Intronic
1032293623 7:130614171-130614193 ACTGGGAAAAAGCACTGGGAAGG + Intronic
1039380666 8:37081909-37081931 GTTTGGAAACAACAGTGGGAAGG + Intergenic
1043609746 8:82047798-82047820 ACTTGGAAATTACTCAGGAAAGG + Intergenic
1045030327 8:98128813-98128835 ACTTGGAAACTGAGATGGGAGGG + Intronic
1045571905 8:103376583-103376605 AATTGGCAAGTCCACTGGGATGG + Intronic
1046618694 8:116504734-116504756 ACTGGGATACTACAAAGGGATGG + Intergenic
1047129263 8:122000744-122000766 ACTTGTAAACAACACAGAGAAGG - Intergenic
1048676037 8:136781245-136781267 ACTTGCAAACCTCACTGGCATGG + Intergenic
1052847054 9:33346129-33346151 GCTTGCAAACTACGCTGGGAGGG - Intronic
1058187808 9:101875821-101875843 GGTTGGAGACAACACTGGGATGG - Intergenic
1058561051 9:106229520-106229542 ACTGGGAAACAAGACTAGGAAGG - Intergenic
1185470985 X:383024-383046 ACTGGGAAAGTGCACTGGGCCGG + Intronic
1188746698 X:33853618-33853640 ACATGGAATCTACACATGGAAGG + Intergenic
1189764418 X:44355707-44355729 AATAGAAAACCACACTGGGATGG + Intergenic
1195866758 X:109440605-109440627 ACAAGGAAACCACACTGAGAAGG + Intronic
1198048482 X:132926298-132926320 GCTTGGCAACTGCAATGGGAAGG + Intronic
1201423391 Y:13823810-13823832 AATTGGGAACTAAACAGGGAGGG + Intergenic
1201558350 Y:15288502-15288524 ACTTTGACACTACACTTGGGAGG - Intergenic