ID: 1110425451

View in Genome Browser
Species Human (GRCh38)
Location 13:75361930-75361952
Sequence CGTTATATAGAGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110425444_1110425451 25 Left 1110425444 13:75361882-75361904 CCTGCCTTATCTGCTTTGAAGGG 0: 1
1: 0
2: 3
3: 12
4: 138
Right 1110425451 13:75361930-75361952 CGTTATATAGAGGTGGAGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 73
1110425447_1110425451 21 Left 1110425447 13:75361886-75361908 CCTTATCTGCTTTGAAGGGGAAA 0: 1
1: 0
2: 1
3: 30
4: 236
Right 1110425451 13:75361930-75361952 CGTTATATAGAGGTGGAGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 73
1110425442_1110425451 28 Left 1110425442 13:75361879-75361901 CCACCTGCCTTATCTGCTTTGAA 0: 1
1: 0
2: 1
3: 26
4: 241
Right 1110425451 13:75361930-75361952 CGTTATATAGAGGTGGAGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110425451 Original CRISPR CGTTATATAGAGGTGGAGCT GGG Intronic
903028260 1:20444673-20444695 AGTTGTGTAGAGGTGGAGCCAGG - Intergenic
904774730 1:32899854-32899876 CATTTTATAGATGTGGAACTTGG - Intronic
906113238 1:43338385-43338407 GGTTATGTAGGGCTGGAGCTGGG - Intronic
908625879 1:66041103-66041125 TGTTGTATAGAGGTGGAGTAGGG + Intronic
911249679 1:95560521-95560543 CATTATATGAAGGTGGAGCAAGG - Intergenic
913050539 1:115113472-115113494 CCTGATATAGAGTTAGAGCTGGG + Intergenic
1064891693 10:20182317-20182339 CTTTATATATAGGTGTAGATTGG - Intronic
1065303812 10:24349945-24349967 CGTTGGATGGAGGTGGAGTTGGG + Intronic
1067180022 10:43978177-43978199 CTTTTTATAGAGGGGTAGCTAGG - Intergenic
1067974557 10:51009405-51009427 CCTTAGATTGAGGTGGAGGTGGG - Intronic
1069407386 10:68116448-68116470 AGTTATTTAGTGTTGGAGCTGGG + Intronic
1074269294 10:111937356-111937378 AGTAATATGGAGATGGAGCTGGG - Intergenic
1080522463 11:33079304-33079326 AATAATATAGAGGTGGAGATGGG - Intronic
1089148256 11:116346077-116346099 CATTTTATAGAGGAGGATCTAGG - Intergenic
1097062912 12:56299560-56299582 CTTTTTATATAGGAGGAGCTTGG - Intronic
1097639071 12:62157558-62157580 AGGTAGATAGAGGTGGAGCCAGG - Intronic
1098177430 12:67807209-67807231 AGTTACTAAGAGGTGGAGCTGGG - Intergenic
1106232248 13:27829884-27829906 CGTTATTTGGGGGTGGAGGTGGG - Intergenic
1107919610 13:45190500-45190522 AGTTATAAAGAGGTGGAACCAGG - Intronic
1110425451 13:75361930-75361952 CGTTATATAGAGGTGGAGCTGGG + Intronic
1116238647 14:42312886-42312908 AGTTATATTGAGGTTGGGCTTGG + Intergenic
1119785813 14:77313416-77313438 CATTAATTAGTGGTGGAGCTGGG - Intronic
1127890037 15:63242283-63242305 CATTGTATAAAGCTGGAGCTAGG + Intronic
1130848887 15:87774275-87774297 CTTTGTTTAGAGGTGGAGATGGG - Intergenic
1134699938 16:16256941-16256963 GGTTACATACAGGTGGATCTGGG - Intronic
1134971887 16:18537718-18537740 GGTTACATACAGGTGGATCTGGG + Intronic
1135161822 16:20103112-20103134 AGTTAAAGAGTGGTGGAGCTGGG + Intergenic
1141511196 16:84513371-84513393 CATTAAAGAGAGGTGGAACTTGG - Intronic
1141521508 16:84583221-84583243 TGTTTTATAGATGAGGAGCTTGG - Intronic
1145085705 17:19937662-19937684 TGTTATATAGATGTTGAGATAGG - Intronic
1151289506 17:73139339-73139361 TGTTATCTAGAAGTGGAGGTAGG + Intergenic
1162758049 19:12872205-12872227 CCTTATAGATAGGAGGAGCTAGG + Intronic
1167148653 19:47696619-47696641 CGCTACCAAGAGGTGGAGCTGGG - Intronic
925822816 2:7817094-7817116 CATTGTAAAGAGGTGGAGCATGG + Intergenic
929624629 2:43393923-43393945 TCTTATATTGAGGAGGAGCTTGG - Intronic
936884552 2:117294528-117294550 CTTTCTATAAAGGTGGATCTAGG - Intergenic
940430331 2:153582952-153582974 TGGCATATAGATGTGGAGCTAGG + Intergenic
944862079 2:203824695-203824717 GGATATACAGACGTGGAGCTAGG + Intergenic
1172938006 20:38634445-38634467 CGTTTGCAAGAGGTGGAGCTTGG + Intronic
1176130315 20:63494016-63494038 CGTGAGATGGAGGCGGAGCTGGG + Intronic
1179111408 21:38448975-38448997 AGTTATAAAGAGGAGGAGCCAGG - Intronic
1181838927 22:25637686-25637708 CATTATATAGATTTGGAGCATGG - Intronic
1183667172 22:39252799-39252821 TGTTGGTTAGAGGTGGAGCTGGG + Intergenic
950502451 3:13373003-13373025 CTTTAGATAGAGGTGGCTCTGGG + Intronic
952946431 3:38480846-38480868 GCTTAGTTAGAGGTGGAGCTGGG + Intronic
963689141 3:148476557-148476579 AGTTATTTAGTGGTAGAGCTGGG - Intergenic
968780208 4:2574692-2574714 CCTTAAATAAATGTGGAGCTGGG + Intronic
974607305 4:64170058-64170080 CCTTATTTAGAAGTGGTGCTAGG - Intergenic
975871816 4:78787475-78787497 CGTTAGACAGAGTGGGAGCTGGG + Intronic
987589268 5:19902552-19902574 CCTTATCTAGAGGTTTAGCTGGG - Intronic
988439613 5:31217786-31217808 AGTTAAATAGAGGCAGAGCTGGG - Intronic
994348776 5:98720037-98720059 ATTTATTTAGAGATGGAGCTTGG + Intergenic
1006372904 6:33656466-33656488 TGTTTTATAGAGTTGGAGCCTGG + Intronic
1013556065 6:111258670-111258692 CGTTGTAAAGAAGTGGAGCGTGG - Intergenic
1014289787 6:119545135-119545157 GGTCACATAGAGGTGGAGCTGGG - Intergenic
1021749953 7:23787134-23787156 CGTTAGCCAGAGGTAGAGCTGGG + Intronic
1031385668 7:121147705-121147727 GGTTATATATAGGAGAAGCTTGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034761024 7:153671892-153671914 CGTTTTATAGACATGGAGTTGGG - Intergenic
1036063225 8:5349141-5349163 TGTGATATGTAGGTGGAGCTTGG + Intergenic
1039613314 8:38936321-38936343 TGTTATGTGGTGGTGGAGCTGGG + Intronic
1042830946 8:73027830-73027852 ACTTATTTAGAGGTGGAGATTGG + Intronic
1043198783 8:77335985-77336007 CCTTATTTGGAGATGGAGCTAGG - Intergenic
1045872133 8:106939158-106939180 GGTGTTATAGAGCTGGAGCTGGG + Intergenic
1048538750 8:135323140-135323162 ACTGATATAGATGTGGAGCTGGG - Intergenic
1048672799 8:136741986-136742008 AGGTATATGGAGGTGCAGCTTGG - Intergenic
1051767224 9:20538470-20538492 CCTGATATTGAGGTGGAGGTTGG - Intronic
1056828395 9:89892321-89892343 TATTATATAGAGGTAGAGCGGGG - Intergenic
1057811725 9:98262518-98262540 CATTTTATGGAAGTGGAGCTGGG - Intergenic
1188293600 X:28418222-28418244 CTTTATATAGGGGTGGTGTTAGG - Intergenic
1188908162 X:35812982-35813004 TGTTATATAGAGAGGGAGGTGGG + Intergenic
1189009536 X:37032944-37032966 AGTTATTTAATGGTGGAGCTAGG + Intergenic
1189039037 X:37522776-37522798 AGTTATTTAATGGTGGAGCTAGG - Intronic
1189203963 X:39221833-39221855 AGGTATATGGAGCTGGAGCTTGG + Intergenic
1198234611 X:134725348-134725370 GGTTATATAGTGGGAGAGCTAGG + Intronic