ID: 1110426678

View in Genome Browser
Species Human (GRCh38)
Location 13:75375110-75375132
Sequence ATCTGAAGCCACAAGTATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110426674_1110426678 22 Left 1110426674 13:75375065-75375087 CCTAATATTTTTCCAACAACAGA 0: 1
1: 0
2: 0
3: 36
4: 339
Right 1110426678 13:75375110-75375132 ATCTGAAGCCACAAGTATTAAGG 0: 1
1: 0
2: 0
3: 13
4: 137
1110426675_1110426678 10 Left 1110426675 13:75375077-75375099 CCAACAACAGAAGACAAGACACA 0: 1
1: 0
2: 1
3: 26
4: 393
Right 1110426678 13:75375110-75375132 ATCTGAAGCCACAAGTATTAAGG 0: 1
1: 0
2: 0
3: 13
4: 137
1110426673_1110426678 23 Left 1110426673 13:75375064-75375086 CCCTAATATTTTTCCAACAACAG 0: 1
1: 0
2: 1
3: 27
4: 346
Right 1110426678 13:75375110-75375132 ATCTGAAGCCACAAGTATTAAGG 0: 1
1: 0
2: 0
3: 13
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110426678 Original CRISPR ATCTGAAGCCACAAGTATTA AGG Intronic
904994161 1:34618005-34618027 ATGTGAAGCCTCAAGTCTAAAGG - Intergenic
906935265 1:50209067-50209089 ATCTTATTCCACAAATATTAGGG + Intergenic
909509801 1:76439348-76439370 ATTTTAAGCCATACGTATTAGGG - Intronic
910546547 1:88425249-88425271 AGCTGAGGGCTCAAGTATTATGG + Intergenic
912087529 1:106028137-106028159 AGCTGAAGCCCCCAGTATCATGG - Intergenic
913562719 1:120038903-120038925 ATCTTAAGCCATGTGTATTATGG + Intronic
913635402 1:120754702-120754724 ATCTTAAGCCATGTGTATTATGG - Intergenic
914283317 1:146198283-146198305 ATCTTAAGCCATGTGTATTATGG + Intronic
914544347 1:148649003-148649025 ATCTTAAGCCATGTGTATTATGG + Intronic
914622285 1:149422007-149422029 ATCTTAAGCCATGTGTATTATGG - Intergenic
914760912 1:150597537-150597559 ATCTGAGGCCAGGAGTTTTAAGG - Intergenic
917180327 1:172289255-172289277 CTCTGAAGCCAGAACTATTGTGG + Intronic
918356986 1:183714033-183714055 ATCTTAAGCCACGAGAAATATGG + Intronic
922942287 1:229477771-229477793 ATTGGAAAACACAAGTATTAAGG + Intronic
924318653 1:242824984-242825006 AGCTGAAGCTACTAGAATTAAGG + Intergenic
924946829 1:248852119-248852141 ATCTAAAACCACAAGTCTTAAGG + Intronic
1068511362 10:57970312-57970334 ATCTCAGACCACATGTATTAGGG - Intergenic
1068730745 10:60355544-60355566 ATCTGAAGCCAAAAATAGTTTGG + Intronic
1068809732 10:61242267-61242289 GTCTGATGCCCCAAGTATCAGGG + Intergenic
1070948343 10:80411263-80411285 ATCTGAAGCCAAATGTCTTAAGG - Intronic
1074477583 10:113786554-113786576 ATATGAAGCCACTAGTTTCATGG + Intergenic
1088834055 11:113562264-113562286 ATCTGAAGCCACCAGGAGTGGGG + Intergenic
1090743444 11:129687810-129687832 ATCTGGAGCCAGAACCATTAAGG - Intergenic
1091913221 12:4248854-4248876 ATCTGAAGCCACAAATACATTGG - Intergenic
1092389093 12:8059660-8059682 ATTTGTAGCCACATCTATTATGG + Exonic
1092766962 12:11861579-11861601 CTCTTAAGCCAGAAGTTTTAGGG + Intronic
1092833633 12:12467986-12468008 GTCTGCAGCCACAAGGATGAAGG + Exonic
1096309707 12:50509873-50509895 ATCTGATGCTAGGAGTATTAAGG + Intronic
1097665841 12:62476345-62476367 ATCTGAAATCACAAGTCTTCAGG + Intronic
1099592630 12:84614018-84614040 TTCTGAAGCCCAAAGTATCAAGG + Intergenic
1105934902 13:25089790-25089812 ATCTTAAGCCACAAGCATGGAGG + Intergenic
1107731037 13:43349221-43349243 TTCTGAAGCCTGAAGTATAACGG - Intronic
1108528929 13:51310750-51310772 AATTGAAGCTAAAAGTATTAGGG + Intergenic
1110426678 13:75375110-75375132 ATCTGAAGCCACAAGTATTAAGG + Intronic
1110844601 13:80179908-80179930 TTCTGAAGACACAAGAATGAAGG + Intergenic
1111252349 13:85619098-85619120 ATATGAAGTCATAAGTGTTAGGG + Intergenic
1114296747 14:21336408-21336430 ATCTGAAGTCCTAAGTATTTGGG + Intronic
1115381633 14:32746282-32746304 ACCTGAAGCCGCAAGTCTCAGGG + Intronic
1116220697 14:42083880-42083902 ATCTGAAGGTACAAATATCACGG - Intergenic
1116562423 14:46397583-46397605 ATATGAAGTCACAAAAATTATGG + Intergenic
1117047940 14:51831512-51831534 ATCAGAAACCACAAGCAATAGGG + Intronic
1117258979 14:54009307-54009329 ACATGAAGCCACATATATTATGG + Intergenic
1117399545 14:55346081-55346103 ATCTGATGCTACATGTTTTATGG + Intronic
1120076331 14:80162950-80162972 ATGTGAAGCCACAAATATTTTGG - Intergenic
1121078482 14:91088809-91088831 ACCTGAAGCCACATGTATTCTGG + Intronic
1124545437 15:30622175-30622197 ATCAGAATCCAGAAGCATTAAGG + Intergenic
1124778956 15:32611575-32611597 ATCAGAATCCAGAAGCATTAAGG + Intergenic
1130768368 15:86897665-86897687 ATTTGAAGCAACAAGAATTAGGG - Intronic
1130796976 15:87220028-87220050 ATCTGAAGCCAGAAGGTGTAAGG + Intergenic
1131929930 15:97430570-97430592 ATCAGATCCCAGAAGTATTAGGG - Intergenic
1134435185 16:14250404-14250426 ATCAAGAGCCACAAGTTTTAGGG - Intronic
1135350965 16:21728570-21728592 ATCTGAAGCCAAAAGAAGAAAGG - Intronic
1137528204 16:49255612-49255634 TTCTGTAGCCATAAGTGTTAGGG - Intergenic
1139902578 16:70339881-70339903 ATCTGTAGCCACAGCTACTAGGG - Intronic
1140671464 16:77283993-77284015 GTCTGCAACCACAAGTTTTACGG - Exonic
1141102845 16:81210670-81210692 ATCTGGAGCCCCAACTATTCAGG - Intergenic
1148230213 17:45928172-45928194 GTGTGAAGCCACAAGAATTTGGG - Intronic
1150501586 17:65656113-65656135 ATCTGGAGCCATAACTATTGAGG + Intronic
1150601845 17:66657814-66657836 TTCAGAAGCCAGAAGTTTTAAGG - Intronic
1153306264 18:3634082-3634104 ATCTGAATACACAAGAATTTTGG + Intronic
1156069906 18:33194487-33194509 ATGTGAAGTCACTAGTATTCAGG - Intronic
1156371743 18:36477314-36477336 ATCTGATGAAACAAATATTAGGG + Intronic
1156801072 18:41114654-41114676 ATCTAATGCCAAAAGTATTATGG - Intergenic
1156876443 18:42019431-42019453 ATGTGCAACCAAAAGTATTAAGG - Intronic
1159801897 18:72910435-72910457 ATCTGCAGCCAGAACTCTTAAGG - Intergenic
1164295278 19:23904334-23904356 ATATAAAGCCTCAAGTTTTATGG + Intergenic
927391862 2:22605072-22605094 ATCTAAAGCCACAAGAAAAATGG - Intergenic
928848614 2:35712845-35712867 ATCTAAATACACAAGTATTCAGG - Intergenic
930309768 2:49725685-49725707 AACTGAAGACACCAGTAATATGG + Intergenic
931506344 2:62931554-62931576 AACTGAAGCCACAAATAATGGGG - Intronic
933215664 2:79627068-79627090 TTCTGAAGCCAAAAGCTTTATGG + Intronic
934014550 2:87865622-87865644 TTCTGAAGCTACAAGTAGCAAGG - Intergenic
934715916 2:96543248-96543270 ATCTGAAGCCAGAATGGTTATGG - Intronic
937927591 2:127179067-127179089 ATCTCAAGCCACTAAGATTATGG - Intergenic
939512714 2:143126767-143126789 ATATCAAGCCACAAGTGTCAAGG + Intronic
942265806 2:174224509-174224531 ATCTGTAGTCCCAAGTATTTGGG + Intronic
1169134029 20:3185559-3185581 ATGTGAAGCCACCGGTAATATGG - Intergenic
1170189979 20:13635773-13635795 ACCTATAGCCACAAGTTTTATGG + Intronic
1172082450 20:32352840-32352862 AACTGAGGCCAGAAGCATTATGG + Intergenic
1175717832 20:61267183-61267205 ATCTGAAGCCACCAAGTTTATGG + Intronic
1177653189 21:23983857-23983879 ATTTGATGCCACAAAAATTACGG + Intergenic
1177879702 21:26677787-26677809 AACTGAAGCCAAAATTATTGAGG - Intergenic
1178558840 21:33618726-33618748 ATCAGAAGCCAAAAGGATTGGGG - Intronic
1184845941 22:47086552-47086574 ATATGAAGCTACAATTATTTCGG + Intronic
949729227 3:7088656-7088678 ATCTGAAGCCACAAGGACATTGG + Intronic
956154949 3:66285773-66285795 ATTTGAAGCCAGATGTATTCTGG + Intronic
956484777 3:69710868-69710890 TTCTGAGGCCACAAGCATTTTGG - Intergenic
957132878 3:76244497-76244519 ATGTAATGCCACAATTATTAGGG - Intronic
962148377 3:132866023-132866045 GTTTGAAGCCACAAGTTTTGGGG + Intergenic
963907662 3:150786458-150786480 ATCTGAAGCCACGGATAGTATGG - Intergenic
964027886 3:152099906-152099928 ATCTGAAGGCTCAACTATTTGGG - Intergenic
965500403 3:169448884-169448906 ACCTGAAGCCAAATGTATTATGG - Intronic
966657060 3:182371164-182371186 ATCTGAAGCCACAACTGGTGAGG - Intergenic
970467497 4:16341300-16341322 ATATGAAGCCACAATTATAGTGG - Intergenic
970607590 4:17695068-17695090 ATCTGAGGCCTCAAGCATCAAGG + Intronic
974601234 4:64082949-64082971 AACTGAAGCCACAACTATATTGG - Intergenic
975678054 4:76847358-76847380 TTCTGGAGCCACAAGTGTCAAGG + Intergenic
977576898 4:98684463-98684485 AACTGAAGCCACCAGTGTTAAGG + Intergenic
981410970 4:144431283-144431305 ATTTGAAGTCACAGGTACTATGG - Intergenic
982940447 4:161545633-161545655 ATCTCCAGCCACAATTATTGTGG - Intronic
985813282 5:2106537-2106559 ATCTGATGCCGTATGTATTATGG - Intergenic
985911701 5:2889271-2889293 ATTTGAAGCCATGAGTAATACGG + Intergenic
986171613 5:5319076-5319098 ATGTGCAGCCACAAGTTCTACGG + Exonic
987022383 5:13887958-13887980 ATTTGAAGACACAGCTATTATGG - Intronic
988990737 5:36668340-36668362 TCCTGATGCCACCAGTATTAAGG + Intronic
989014461 5:36913512-36913534 ATCTGTAGTCCCAAGTATTTAGG - Intronic
990659021 5:57991796-57991818 ATTTGAAGCCTGAAGTGTTATGG + Intergenic
991438722 5:66623176-66623198 ATCTGTAGCTACAAGGATTATGG + Intronic
992423437 5:76630109-76630131 ATCAGAAGCCACAAGTCACAAGG + Intronic
992916478 5:81458776-81458798 AACAGAAGCAAAAAGTATTAAGG - Intronic
995743501 5:115378992-115379014 GTTTTAAGCCACAAGTTTTAGGG + Intergenic
996493874 5:124130662-124130684 ATAAGAAGCCTCAAGTATTGAGG - Intergenic
998956229 5:147441341-147441363 ATGTGAGGACACAAGGATTAGGG - Intronic
999068792 5:148720267-148720289 ATTTGCAGCCAAAAGTATTGTGG - Intergenic
1000435082 5:161198009-161198031 ATCTGAAGCCACAAGTCACTAGG - Intergenic
1001626323 5:173138156-173138178 AAAAGAATCCACAAGTATTACGG - Exonic
1006301946 6:33198393-33198415 ATGTGAAGCCACCAGTCTTAGGG - Exonic
1010102570 6:72126300-72126322 ACCTGAAACCATAAGTATTCTGG + Intronic
1010363405 6:75021522-75021544 ATCTGCAACCACAAGTAAAATGG + Intergenic
1012739794 6:103001705-103001727 GTTTGAAGCCTCAAGTGTTAAGG + Intergenic
1015866734 6:137734592-137734614 ATCTGAGGTAACAAGTATTCTGG + Intergenic
1019680633 7:2346793-2346815 ACCTGTAGCCACAAGTACTCAGG + Intronic
1020196841 7:6046936-6046958 ATCTGAAAACACAATTATTTAGG + Intronic
1020822432 7:12987571-12987593 ATCAATATCCACAAGTATTAAGG - Intergenic
1021091768 7:16491719-16491741 ATCTGAATCAATAAATATTAAGG + Intronic
1023371127 7:39513140-39513162 TTCTTAAGCCATAAATATTAGGG + Intergenic
1024303472 7:47905656-47905678 TTCTGAAACCACAGGCATTAAGG - Intronic
1030202630 7:106920510-106920532 AAATGAAGGCAAAAGTATTAAGG + Intergenic
1039222618 8:35351461-35351483 ATTTGAAGTCTCAAGTATTATGG + Intronic
1041851417 8:62397534-62397556 ATCAGAAACCACAACTATAATGG + Intronic
1045988841 8:108282392-108282414 CTCTGAAGCCACAAGAATTTTGG + Intronic
1046822010 8:118644068-118644090 ATCTTAAGCCTCAAAGATTAAGG - Intergenic
1055170025 9:73245681-73245703 ATAAGATGCCGCAAGTATTAAGG - Intergenic
1055258382 9:74401337-74401359 TTATGAAGCCTAAAGTATTAGGG - Intergenic
1058451689 9:105102499-105102521 ATCTGAGGAAACAAGCATTAGGG - Intergenic
1058669492 9:107348463-107348485 ATCTGGAGCCACAAATATGGCGG - Intergenic
1059812801 9:117874926-117874948 ATCATCAGCCACAAGTATTTAGG + Intergenic
1060443336 9:123662436-123662458 ACCTGTAGCCACAACTATTTGGG + Intronic
1186409902 X:9337643-9337665 ATCGGAAGCCACCACTATTTGGG - Intergenic
1188226869 X:27610725-27610747 ATCTAAAGCTACAAGGATTGTGG + Intronic
1188488755 X:30713318-30713340 GACTGAAGCCACAAGCATGATGG - Intronic
1192348197 X:70330319-70330341 ATCTAAAGCAACAGGTATAAGGG + Exonic
1192963912 X:76157542-76157564 AGCTGGACCCACAAGTACTAGGG + Intergenic
1193795421 X:85867141-85867163 ATTGTAATCCACAAGTATTAGGG + Intronic
1193859595 X:86648575-86648597 ATCTGAAGACACAGATATTCAGG + Intronic
1196223050 X:113134768-113134790 TTCTGAAGAAACAAGAATTAAGG - Intergenic
1196657986 X:118239955-118239977 ATCTTAAGCCACCAGTACTGTGG + Intergenic
1199129927 X:144172889-144172911 TTCTGAAGCTACAAGTAGCAAGG + Intergenic
1199838212 X:151615109-151615131 ATCTGATGCCACAAGAATTTGGG - Intronic
1201374768 Y:13306964-13306986 ACCTGAAGCCAAAAGTACTGAGG + Intronic
1201510182 Y:14750611-14750633 ATCAGAAACCACAAATAATAAGG + Intronic