ID: 1110430745

View in Genome Browser
Species Human (GRCh38)
Location 13:75420173-75420195
Sequence TGCCATCTTCCAGAAGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 191}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110430737_1110430745 24 Left 1110430737 13:75420126-75420148 CCTGGATCCAGGAAACTCCTCAG 0: 1
1: 0
2: 3
3: 22
4: 260
Right 1110430745 13:75420173-75420195 TGCCATCTTCCAGAAGGGGTGGG 0: 1
1: 0
2: 2
3: 23
4: 191
1110430739_1110430745 17 Left 1110430739 13:75420133-75420155 CCAGGAAACTCCTCAGTGGCTAT 0: 1
1: 0
2: 2
3: 11
4: 137
Right 1110430745 13:75420173-75420195 TGCCATCTTCCAGAAGGGGTGGG 0: 1
1: 0
2: 2
3: 23
4: 191
1110430740_1110430745 7 Left 1110430740 13:75420143-75420165 CCTCAGTGGCTATAGTAAGAAGT 0: 1
1: 0
2: 0
3: 12
4: 124
Right 1110430745 13:75420173-75420195 TGCCATCTTCCAGAAGGGGTGGG 0: 1
1: 0
2: 2
3: 23
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110430745 Original CRISPR TGCCATCTTCCAGAAGGGGT GGG Intronic
901051090 1:6426241-6426263 GGCCATCTCCCAGGAAGGGTGGG - Intronic
902887427 1:19415966-19415988 TCCCATCGTCCAGAGTGGGTTGG - Intronic
903376689 1:22870748-22870770 TGCCAGCTTCCGGAAGTAGTGGG + Intronic
903589101 1:24440804-24440826 TGCCTTCTGCCAGCAGGGGTGGG + Intronic
903790679 1:25890880-25890902 TGCCATTTTCCAGATGGCGGGGG - Intronic
903878430 1:26492135-26492157 TGTCATCTTGCAAAAGTGGTGGG - Intergenic
905005991 1:34710930-34710952 TGCCAGCTTGCAGAAGGTTTGGG - Intergenic
905356969 1:37391518-37391540 TGCCAACTCCCTGTAGGGGTGGG + Intergenic
905933635 1:41806926-41806948 TCCCATCCTCCTGAAGGTGTAGG - Intronic
906109155 1:43311936-43311958 TGGCAGCTTCTAGAAGAGGTGGG + Intronic
908123303 1:61006125-61006147 AGCCATCCTCCAGCAGGGCTTGG + Intronic
909204170 1:72731804-72731826 TGCCAGGTTACAGGAGGGGTTGG + Intergenic
911853703 1:102851524-102851546 TACCATCTTCCTGGAGGGCTGGG - Intergenic
912099199 1:106184888-106184910 TGGCAGCTTCCAGATGGTGTTGG + Intergenic
912672942 1:111648417-111648439 TGCCATCTTCCAGCAGGTGGTGG + Intronic
912710893 1:111948970-111948992 TGCCATATTCCAGCATGGGCAGG + Intronic
914863420 1:151405533-151405555 TGCCATCTGCCAGAATGGCTAGG + Exonic
915146662 1:153799693-153799715 GGCCATCTGCAAGAAGGCGTTGG - Intergenic
915284828 1:154845990-154846012 TGCCATCTTCCAAAGGGGACTGG - Intronic
916743172 1:167663655-167663677 TCCCATCTTGCAGAATAGGTTGG - Intronic
918675572 1:187280871-187280893 TGACATCTTCCAGGAGGAGAAGG + Intergenic
923198822 1:231692467-231692489 TGCCATCTCCTAAAAGGGGTGGG - Intronic
1063220013 10:3958354-3958376 TGCCCTCTCCCAGAAGTGGCCGG - Intergenic
1067211564 10:44263898-44263920 AAGCATCTTCCAGATGGGGTGGG + Intergenic
1069782746 10:70967064-70967086 TGCCAGCTACCAGATGGGGGAGG - Intergenic
1071264607 10:83953787-83953809 TGGCTTCTTGGAGAAGGGGTGGG - Intergenic
1072048962 10:91684584-91684606 CCCCATCTTCAAGGAGGGGTGGG - Intergenic
1072511002 10:96124682-96124704 TGCCACCTTGGAGGAGGGGTTGG + Intergenic
1073047562 10:100649632-100649654 GGCCATCATCAAGATGGGGTGGG + Intergenic
1073867512 10:107821760-107821782 TACCACCTTGCAGAAAGGGTAGG + Intergenic
1075266072 10:121000432-121000454 TGCCATCATCCAGGAGGGAGTGG + Intergenic
1075733211 10:124648482-124648504 TGCCATTTTACAGATGGGGGAGG - Intronic
1075824347 10:125341971-125341993 GGCCAACTTCCAGGATGGGTTGG + Intergenic
1076821978 10:132943856-132943878 TGCCAACTTCAAGACGGGGTGGG - Intergenic
1077049257 11:559405-559427 TACCAGCACCCAGAAGGGGTGGG + Intronic
1080704585 11:34678353-34678375 TGCCTTCAGCCAGAAGGGGCAGG + Intergenic
1081693129 11:45091963-45091985 TGCCTTCTTCCTGAAGTGGAAGG + Intergenic
1083261733 11:61526847-61526869 TGTCATCTTGCAGAAGAGGTGGG + Intronic
1084937777 11:72596205-72596227 TGGGATCCTCCAGATGGGGTGGG - Intronic
1086172620 11:83852936-83852958 TGCCATGTTCAAGAAGAGTTTGG - Intronic
1086418550 11:86614535-86614557 TGCCTGCTTTGAGAAGGGGTTGG - Intronic
1088486585 11:110346734-110346756 TCCCATCTTCCTGAAGAGCTGGG + Intergenic
1091053419 11:132395888-132395910 TTGCATCTTCCCCAAGGGGTAGG - Intergenic
1091206629 11:133825767-133825789 TGCAAACTTCCAGAAAGGGCTGG - Intergenic
1092040101 12:5376694-5376716 TGACATCTGTGAGAAGGGGTTGG + Intergenic
1096363892 12:51011931-51011953 TTCAATCTTCTAGAAAGGGTAGG + Intronic
1096634965 12:52952310-52952332 CGCCATCTTCCAGCAGGCGGCGG - Exonic
1097201412 12:57282007-57282029 TGCCATATTCAAGAAATGGTTGG + Intronic
1098728299 12:73998023-73998045 TGTCATCTTCCAGAATGTGTTGG - Intergenic
1101468894 12:104976879-104976901 CGCCATCTTCCAGCAGGCGGCGG + Intergenic
1101953966 12:109197574-109197596 TGTCATCTTCCCGAATGGGCTGG - Intronic
1105557464 13:21459857-21459879 TTCCATCTTCAAGAAAGGGAGGG - Intergenic
1107663213 13:42661314-42661336 TGCTATGTTCCTGAAAGGGTGGG + Intergenic
1108545203 13:51486779-51486801 TGCATTCTCCCAGAATGGGTGGG - Intergenic
1110430745 13:75420173-75420195 TGCCATCTTCCAGAAGGGGTGGG + Intronic
1114267379 14:21080917-21080939 TGCCACCTCCCAGAAGGTGCTGG + Exonic
1116742662 14:48776514-48776536 TGGCAGCTTCCACATGGGGTAGG + Intergenic
1116986448 14:51224758-51224780 TGCCAGCTTCCAGGAAGGGTGGG + Intergenic
1120250454 14:82057046-82057068 TGACTTATTCCAGAAGGGGTGGG + Intergenic
1120673749 14:87394450-87394472 TGCCATCTTCCACCAGGCCTTGG + Intergenic
1120987752 14:90348852-90348874 TGCCACCTTCCCGAAGGGTCTGG - Intergenic
1121722115 14:96116588-96116610 TGCCAACTGCCACAAGGGGCTGG + Intergenic
1122136099 14:99633764-99633786 TGCCATGTTACAGATGGGGAAGG - Intergenic
1122221382 14:100240494-100240516 TGGCACCTTCCAGAAGGAGGGGG + Intronic
1122937268 14:104966035-104966057 AGCCATCTTGCAGAAGGGCAAGG - Intronic
1124377689 15:29139059-29139081 TGCCTTCTGGCAGCAGGGGTAGG + Intronic
1125069619 15:35537324-35537346 TGCCATTTTTCACAAGGGGAAGG - Intronic
1126670984 15:51114655-51114677 TGCCATGTGCCAGAAGAGGTGGG + Intergenic
1127961201 15:63892211-63892233 TGCCATCTTCCAGAAGACCTAGG - Intergenic
1128432668 15:67613204-67613226 AGCCATCTTCCAGAAGAGTAAGG + Intronic
1129153884 15:73705527-73705549 TTCCATCTTGGGGAAGGGGTGGG - Intronic
1135425116 16:22328604-22328626 TGCCATCTTCCCGAAGAGCCAGG + Intronic
1136290725 16:29269878-29269900 AGGAAACTTCCAGAAGGGGTGGG - Intergenic
1138220801 16:55248683-55248705 TGCCACCTTCCAGAAAGGCCAGG - Intergenic
1138537142 16:57666210-57666232 CCCCATCTTCCAGAATGGGGGGG + Intergenic
1139107735 16:63848366-63848388 AGCAATCTTCCACAAGGGCTAGG + Intergenic
1139589797 16:67927258-67927280 TGGCCTCATCCAGATGGGGTGGG + Intronic
1139958750 16:70705764-70705786 TGGCAAGTTCCAGGAGGGGTGGG + Intronic
1140034450 16:71361619-71361641 AGCCAGCATCCAGAAGGGGTGGG - Intronic
1141772579 16:86099741-86099763 TGCCATCTTGTAAAAGGAGTGGG + Intergenic
1141925980 16:87169947-87169969 TGCCATCTTCCCGCAGAGGAAGG + Intronic
1142096605 16:88243398-88243420 AGGAAACTTCCAGAAGGGGTGGG - Intergenic
1142103246 16:88286648-88286670 TGCCATCATTCAGCAGGGGCTGG + Intergenic
1144679280 17:17182172-17182194 TTCCATCTTCTTGAAGGGTTGGG - Intronic
1145104766 17:20105812-20105834 TGCCCCCTTCCATAAGGGGTTGG - Intronic
1145904953 17:28511196-28511218 TGCCATCTTGCACAGGGGATGGG - Intronic
1148229703 17:45924196-45924218 TGCCATCTTGGACAGGGGGTTGG - Intronic
1148661611 17:49338321-49338343 TGACATCTAGCAGAAGGTGTTGG - Intronic
1148715982 17:49716277-49716299 TGCCATCTTCAAGAAAGGCTGGG + Exonic
1148754621 17:49966341-49966363 TCCCATATTCCAGAGGGTGTGGG - Intergenic
1148984643 17:51611088-51611110 TGCCTTCTTCCAGAGAGGTTAGG - Intergenic
1151694466 17:75707124-75707146 AGCCAGTTTCCAGAAGGGCTGGG + Exonic
1155026591 18:21946149-21946171 TGCCATTTTCTGGAAGGAGTGGG + Intergenic
1157071819 18:44416926-44416948 AGACACCTTCCAGCAGGGGTTGG + Intergenic
1157457231 18:47843336-47843358 AGCCATCTACCAGAGTGGGTGGG - Intronic
1158333365 18:56387606-56387628 TGCCATCATACAGAAGCTGTAGG - Intergenic
1163330299 19:16632369-16632391 TCCCATCTTCAAGTAGGGATGGG + Intronic
1163398438 19:17077247-17077269 TGGGATCTGCCAGAAGGGCTGGG + Intronic
1163987060 19:20963217-20963239 CGCCATCTTCCAGCAGGCGGTGG - Intergenic
1163987247 19:20965047-20965069 TGCCATCTTCCAGCAGGCGGCGG - Intergenic
1164836885 19:31361136-31361158 TGATTTCTTACAGAAGGGGTTGG + Intergenic
1166192432 19:41183887-41183909 TGGCAGCTTCCAGAATGGTTAGG + Intergenic
1168257766 19:55175935-55175957 TGGCTCCTTTCAGAAGGGGTTGG + Intronic
925988218 2:9232903-9232925 TTCCTTCTTCCAGAAGGGCAAGG - Intronic
926292357 2:11541171-11541193 GGCCATCTCCCAGAAGGAGATGG + Intronic
927844006 2:26462078-26462100 TGACATCTTCGTGAGGGGGTGGG - Exonic
928495009 2:31822735-31822757 TGCCATCTTCCAGCAGGCGGCGG + Intergenic
932743063 2:74306856-74306878 TGCCATCTTCCAGCAGGCAGTGG + Intronic
932749782 2:74363941-74363963 TGCCATCTCCAAGAAGGGCACGG + Intronic
932817110 2:74870927-74870949 GGCCATCTTCCAGATTGGGGTGG + Intronic
933093215 2:78146408-78146430 TGTGATCTTGCAGAAGGGTTAGG + Intergenic
934753822 2:96811306-96811328 TGCCAGCTTCCAAAAGGACTTGG - Exonic
940084200 2:149839548-149839570 AGACATCTCCCAGCAGGGGTTGG - Intergenic
941562953 2:167071735-167071757 TGCCAGCTTCCAGAAGAAGTAGG - Intronic
941645041 2:168031182-168031204 TGACATCTCCCAGAAGGGCAAGG + Intronic
942296512 2:174523070-174523092 TTCCATCTCCCAGTAGGAGTTGG + Intergenic
943504472 2:188736432-188736454 TGCTAATTTCCAGAATGGGTCGG - Intronic
944855630 2:203764425-203764447 CGCCATCTTCCAGCAGGCGGCGG + Intergenic
946404580 2:219485428-219485450 TGCCAGCGTCCAGGAGGAGTTGG + Exonic
946896534 2:224329914-224329936 TGCCAGTTTGCAGAAGGAGTAGG - Intergenic
948271039 2:236673499-236673521 TTCCATCTTGCAGAAGGTGGTGG - Intergenic
948456107 2:238105323-238105345 TGCCATCTTCAAGGGGGGGCTGG + Intronic
948584062 2:239007582-239007604 TGCCATCTTCCAGTCGGGAAAGG + Intergenic
1168911799 20:1454146-1454168 TGCCATTTTTCTGAAGGGATTGG - Intronic
1174615897 20:51835189-51835211 TGCCATTTTCCAAGATGGGTAGG - Intergenic
1175197954 20:57258476-57258498 GACCATCTTCCAGAAAGGATTGG + Intronic
1175741398 20:61422040-61422062 TGACATCTTCCAGATGTGATCGG - Intronic
1175870216 20:62205822-62205844 TGCCATCGTCCAGAGCGGGGTGG - Intergenic
1177387294 21:20425080-20425102 CACCATCTTCCAGCAGGGGGTGG + Intergenic
1178902923 21:36612004-36612026 TGCCTAGTTCCAGAAAGGGTTGG + Intergenic
1181579866 22:23822219-23822241 TGCCCAGTTCCAGCAGGGGTTGG + Intronic
1181852928 22:25762853-25762875 TCCCAGTTTCCAGAAGGGGATGG - Intronic
1183622316 22:38981821-38981843 TCCCAGCTTCCAGAAGGTGGGGG - Intronic
1183627482 22:39013720-39013742 TCCCAGCTTCCAGAAGGTGGGGG - Intergenic
949856276 3:8464266-8464288 TGCCATGTTTCAGAAATGGTTGG - Intergenic
950332770 3:12169678-12169700 TACAATCTTTCAGAATGGGTAGG - Intronic
950403251 3:12787520-12787542 CGCCATCTTCCAGCAGGCGGCGG + Intergenic
950663667 3:14482217-14482239 GGCCATGTTCCTGAAGCGGTGGG + Intronic
951087839 3:18535535-18535557 TGGCTTTTTCCAGAAGGAGTTGG + Intergenic
953769998 3:45772436-45772458 TGCCACCTTCCAGGATGGGTGGG - Intronic
956688378 3:71853636-71853658 TTCCACCTTCCAGCAGTGGTCGG + Intergenic
957871032 3:86090730-86090752 TGCCATGTGCCATAAGGGATGGG - Intergenic
960288360 3:115855231-115855253 TGCCATCTTCCAGAATTGGTAGG - Intronic
960971118 3:123140971-123140993 TGCCAGCTTCCATCAGCGGTGGG - Intronic
962029451 3:131583958-131583980 TGCCTTCTTCTAGAAGGTCTTGG + Intronic
963328346 3:143886888-143886910 TGTCATCTGCCAGAAGGACTGGG + Intergenic
964381622 3:156103491-156103513 TGCCATTTTCCAGATGGGGATGG - Intronic
964483283 3:157162794-157162816 TGCCATCTTCCAGCAGGCGGCGG + Intergenic
965057261 3:163737649-163737671 TGCCAACTTCAGGAAGAGGTAGG - Intergenic
967432106 3:189397558-189397580 TGCCATCCACCAGAACGTGTTGG + Intergenic
967501583 3:190203998-190204020 TGGCAGCTTCCAGGAGGTGTTGG + Intergenic
967941422 3:194769278-194769300 ATCAATCATCCAGAAGGGGTGGG - Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969834214 4:9826163-9826185 TTGCAGCTTCCAGAAGGGTTTGG + Intronic
971006216 4:22376738-22376760 TCTCATCTCCCAGCAGGGGTTGG - Intronic
972339423 4:38138395-38138417 TGACTTCTTGCAGAAGGAGTAGG + Exonic
972705442 4:41538293-41538315 TCCCATCTCCCAGAGTGGGTTGG + Intronic
972844094 4:42966619-42966641 TGCCATAGTCAAGAAGGAGTTGG + Intronic
976331401 4:83834944-83834966 TGCCATCCTTCACAAGGGTTGGG + Intergenic
982242098 4:153310015-153310037 TGTAATCTTCCTGGAGGGGTAGG + Intronic
983131742 4:164028559-164028581 TGCAAACTACTAGAAGGGGTAGG + Intronic
983708838 4:170689794-170689816 TGCCATCTATCAGAATAGGTTGG + Intergenic
989012293 5:36886344-36886366 TGCCATCTTCAAGCAGGCGGTGG - Intronic
991294981 5:65071151-65071173 TGACACCATCCAGAAGTGGTAGG - Intergenic
992154294 5:73939615-73939637 TCCCATCTTCCAGTAGGAGGTGG - Intronic
992807588 5:80352515-80352537 TGCCATTTTTCAGAAGGGCATGG + Intergenic
999360357 5:150980515-150980537 TTCCATCTAACAGTAGGGGTAGG + Intergenic
1000112677 5:158123910-158123932 TGCCATGTGCCACAAAGGGTGGG + Intergenic
1001368493 5:171169811-171169833 TCCCGTCTTCCAGAAAGGGGTGG + Intronic
1001873400 5:175178379-175178401 TGCCATCTTACAGAAAGAATGGG + Intergenic
1005471201 6:26164272-26164294 TGGCATCTTCCAGGATGGGCTGG - Intronic
1005761132 6:28969262-28969284 CGCCATCTTCCAGCAGGCGGCGG + Intergenic
1006465383 6:34190916-34190938 TGCCGTCTTCCAGCAGGTGGTGG - Intergenic
1007092333 6:39191909-39191931 TCCCATCTTCCTCAAGGGCTTGG + Intronic
1009808990 6:68636520-68636542 TTCCCTCTTAAAGAAGGGGTGGG - Intronic
1010458205 6:76082951-76082973 TGGCAGCTTCCACAAGGTGTTGG - Intergenic
1012222669 6:96668700-96668722 CTTCATCTTCCAGAAGTGGTTGG + Intergenic
1014009160 6:116457453-116457475 CGCCATCTTCCAGCAGGCATTGG + Intergenic
1015634587 6:135263232-135263254 ACCCAGCTTCCAGAATGGGTAGG - Intergenic
1019694507 7:2437791-2437813 TTCCTTCTTCCAGAGGGTGTAGG + Intergenic
1024209369 7:47190557-47190579 TGCCAGGTTCCAGGTGGGGTTGG + Intergenic
1025058833 7:55786841-55786863 TGCCCTTTTCCAGAAGGTGAAGG + Intergenic
1026006482 7:66604036-66604058 TGCCCTTTTCCAGAAGGTGGAGG + Intergenic
1028289287 7:89045159-89045181 TGGCAGCTTCCAGGAGGTGTTGG + Intronic
1033452631 7:141475192-141475214 TGCCATCTTCCAGCTGGTGTGGG + Exonic
1034043606 7:147905234-147905256 TGTCAGCTTCCTGAAGAGGTAGG - Intronic
1034266849 7:149785292-149785314 TTCCCTCCACCAGAAGGGGTCGG + Intergenic
1034376602 7:150650336-150650358 TGGAATCTTCCAGAAATGGTGGG + Intergenic
1034694456 7:153041662-153041684 TTGCATCTTCAAGAACGGGTAGG - Intergenic
1037979113 8:23238070-23238092 TGCCAGCTTCCACATGGTGTTGG - Intergenic
1040761177 8:50846133-50846155 TGCCATATTCAAGAGGTGGTTGG + Intergenic
1041644203 8:60234949-60234971 GGCCAAGTTCCAGAATGGGTTGG - Intronic
1041897226 8:62938680-62938702 TCCCCTCTTCCCGTAGGGGTGGG - Intronic
1042086268 8:65112576-65112598 TGCCATCTCACAGAGGAGGTGGG - Intergenic
1048201752 8:132380519-132380541 TGCCCACTTCCAGAAAGGGTGGG + Intronic
1048374697 8:133812911-133812933 TGCCACCTTCATGGAGGGGTGGG + Intergenic
1049508511 8:143016190-143016212 CGCCGTCTCCCGGAAGGGGTGGG - Intergenic
1051066898 9:13115471-13115493 AGCCATTTTCCACAAGGGATTGG - Intronic
1051178511 9:14385397-14385419 AGCCATCATACAGAGGGGGTTGG + Intronic
1051342039 9:16120827-16120849 TGTCATCTGCCAGAAGGCCTTGG - Intergenic
1051648056 9:19290392-19290414 TACCATTTTCCACAAGGTGTTGG + Intronic
1052612912 9:30799593-30799615 CGCCATCTTCCAGCAGGTGGTGG + Intergenic
1057127105 9:92625794-92625816 TGCCTTCTTCCAGAGAGGATAGG - Intronic
1057865656 9:98678443-98678465 TGCCAGCTGCCAGCAGGGGCAGG - Intronic
1058118748 9:101115190-101115212 AGCCATCTTCCAGAAGTGAGTGG - Intronic
1059756562 9:117299307-117299329 TGCCAGCTCTCAGAAGAGGTTGG - Intronic
1062100381 9:134724933-134724955 TGCCATCCTCCAGATGGGGTTGG + Intronic
1187549587 X:20288585-20288607 TGGCAACTTCCTGCAGGGGTTGG + Intergenic
1187667776 X:21633129-21633151 TGCCATTTTCCGGGAGGGGATGG - Intronic
1188344479 X:29046732-29046754 TGCCATGCTCCAGAGGTGGTAGG - Intronic
1188868739 X:35347780-35347802 GGGCATGTTCTAGAAGGGGTTGG - Intergenic
1194322078 X:92460799-92460821 CGCCATCTTCCAGCAGGCGGCGG - Intronic
1195667644 X:107445258-107445280 AGCCAGCTTCGCGAAGGGGTTGG + Intergenic
1199301730 X:146221193-146221215 TGCCAGCTTCCAGGTGGTGTCGG - Intergenic
1199877796 X:151948682-151948704 TGCCATGTACTAGAAGGGGTCGG - Intergenic
1200226269 X:154419547-154419569 TGGCGTCTACCAGAAGGGGATGG + Exonic
1200630241 Y:5574278-5574300 CGCCATCTTCCAGCAGGCGGCGG - Intronic