ID: 1110432717

View in Genome Browser
Species Human (GRCh38)
Location 13:75443749-75443771
Sequence TGTGATTCTGAGTAGGGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 863
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 826}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110432717_1110432725 28 Left 1110432717 13:75443749-75443771 CCCTGTCCCTACTCAGAATCACA 0: 1
1: 0
2: 0
3: 36
4: 826
Right 1110432725 13:75443800-75443822 GCCAAGGTGAATGTTTAACATGG 0: 1
1: 0
2: 0
3: 12
4: 212
1110432717_1110432723 12 Left 1110432717 13:75443749-75443771 CCCTGTCCCTACTCAGAATCACA 0: 1
1: 0
2: 0
3: 36
4: 826
Right 1110432723 13:75443784-75443806 GCAGAGACCAGGAAAAGCCAAGG 0: 1
1: 1
2: 5
3: 48
4: 425
1110432717_1110432721 1 Left 1110432717 13:75443749-75443771 CCCTGTCCCTACTCAGAATCACA 0: 1
1: 0
2: 0
3: 36
4: 826
Right 1110432721 13:75443773-75443795 CTACCACAACTGCAGAGACCAGG 0: 1
1: 0
2: 1
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110432717 Original CRISPR TGTGATTCTGAGTAGGGACA GGG (reversed) Intronic
900286542 1:1903690-1903712 TGTATTTCTTAGTAGAGACAGGG + Intergenic
900688518 1:3965123-3965145 TGTGTTTTTTGGTAGGGACAGGG - Intergenic
901394135 1:8968136-8968158 TTTTATTTTTAGTAGGGACAGGG + Intronic
901596136 1:10386720-10386742 TGTATTTCTTAGTAGAGACAGGG + Intergenic
901920390 1:12531994-12532016 TGTTATTTTTAGTAGAGACAGGG + Intergenic
902039469 1:13482402-13482424 TGTTATTTTTAGTAGAGACAGGG - Intronic
903237614 1:21960341-21960363 TGTAATTTTTAGTAGAGACAGGG - Intergenic
903336595 1:22628452-22628474 TGTTTTTTTCAGTAGGGACAGGG - Intergenic
903545398 1:24120754-24120776 TGTGACACTGGGTAGGGACAGGG + Exonic
903564080 1:24251417-24251439 TGTGGTTGTGGGTAGGCACAGGG + Intergenic
903632278 1:24784648-24784670 GGTGATGCTGAGTAAGGAAATGG + Intronic
903766943 1:25741152-25741174 TGTGACTTTTAGTAGAGACAGGG + Intronic
903837950 1:26218072-26218094 TTTGATTTTTAGTAGAGACAGGG + Intergenic
904048616 1:27624408-27624430 TTTGATTTTTAGTAGAGACAAGG + Intronic
905211277 1:36375846-36375868 TGTTATTTTTAGTAGAGACAGGG - Intronic
905419404 1:37829606-37829628 TGTGTTTTTTAGTAGAGACAGGG - Intronic
905794496 1:40807943-40807965 TTTGATTTTTAGTAGAGACAAGG - Intronic
906116816 1:43362688-43362710 TGTGTTTTTTAGTAGAGACAGGG - Intronic
906468289 1:46104754-46104776 TGTAATTTTTAGTAGAGACAGGG - Intronic
907211696 1:52829256-52829278 TGTTATTTTTAGTAGAGACAGGG - Intergenic
907835059 1:58101140-58101162 TGTGTTTTTTAGTAGAGACAGGG - Intronic
908133070 1:61096374-61096396 TGTAATTTTTAGTAGAGACAGGG + Intronic
908222861 1:62025646-62025668 TGGCATTTTTAGTAGGGACAGGG - Intronic
908825709 1:68131083-68131105 TGTGTTTTTAAGTAGAGACAGGG + Intronic
909028814 1:70514937-70514959 TGTAATTTTTAGTAGAGACAGGG - Intergenic
909052483 1:70783187-70783209 TGTATTTTTTAGTAGGGACAGGG + Intergenic
909097988 1:71313845-71313867 TGGGATTTTTAGTAGAGACAGGG + Intergenic
910422096 1:87077166-87077188 GATGATTCTCAGTAGGGATATGG + Intronic
910900114 1:92111163-92111185 TGTGCTTTTTAGTAGAGACAGGG + Intronic
911594628 1:99786313-99786335 TGTTATTTTTAGTAGAGACAGGG - Intergenic
911970399 1:104428267-104428289 TGTTATTTTTAGTAGAGACAGGG + Intergenic
912149206 1:106836374-106836396 TTTGATTTTTAGTAGAGACAAGG - Intergenic
912529589 1:110310622-110310644 TGAGAATCTCAGTAGGGGCAGGG + Intergenic
912961640 1:114201331-114201353 TTTGATTCTAAGAAGGGAGAAGG - Intergenic
913304014 1:117404878-117404900 TGTTATTTTTAGTAGAGACAGGG - Intronic
913694251 1:121308764-121308786 TGTGTTTTTTAGTAGAGACAGGG - Intronic
914143313 1:144971301-144971323 TGTGTTTTTTAGTAGAGACAGGG + Intronic
914854183 1:151338328-151338350 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
915195442 1:154185507-154185529 TGTGGTTTTTAGTAGAGACAGGG - Intronic
915227447 1:154421359-154421381 TGGGTTTCTGAGCAGGGACATGG + Intronic
915680680 1:157579193-157579215 TTTTATTCTGTGTAGAGACAAGG - Intronic
916875318 1:168962573-168962595 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
917265634 1:173217919-173217941 TTTTATTCTTTGTAGGGACAGGG + Intergenic
917281900 1:173385663-173385685 TGTAATTTTTAGTAGAGACAGGG - Intergenic
917422538 1:174879917-174879939 TGTTATTTTTAGTAGAGACAAGG - Intronic
917797803 1:178544145-178544167 TTTTATTCTTAGTAGAGACAGGG + Intronic
918100732 1:181371445-181371467 TTTTATTCTTAGTAGAGACAAGG + Intergenic
918603503 1:186392828-186392850 TGTTATTTTTAGTAGAGACAGGG - Intronic
918971111 1:191420619-191420641 TTTTATTTTTAGTAGGGACAGGG + Intergenic
919358984 1:196566458-196566480 TATGTTTATGAGTAGGAACATGG + Intronic
919596040 1:199563390-199563412 TGTTATTTTTAGTAGAGACAGGG - Intergenic
919885687 1:201932577-201932599 TTTTATTTTGAGTAGAGACAGGG - Intronic
919901983 1:202050644-202050666 TATTATTTTTAGTAGGGACAGGG - Intergenic
920481577 1:206327152-206327174 TGTGTTTTTTAGTAGAGACAGGG - Intronic
921024919 1:211269421-211269443 TGTTATTTTTAGTAGAGACAGGG - Intronic
921136838 1:212268639-212268661 TGTTATTTTTAGTAGAGACAGGG + Intergenic
921344032 1:214163454-214163476 TTGGATTCTTAGTAGAGACAGGG - Intergenic
921542215 1:216430204-216430226 TGTTATTTTTAGTAGAGACAGGG - Intergenic
921811352 1:219517988-219518010 TGTAATTTTTTGTAGGGACAGGG + Intergenic
921924148 1:220697856-220697878 TGTGCCTCTAGGTAGGGACAAGG + Exonic
922189149 1:223301948-223301970 TGAGATTTTGGGTGGGGACACGG - Intronic
922354350 1:224761823-224761845 TCTGATTCAGAATATGGACAGGG - Intergenic
922526300 1:226307069-226307091 TGTGGTTCTTTGTAGGGACTTGG - Intronic
922710870 1:227830675-227830697 TATTATTTTTAGTAGGGACAGGG + Intronic
923306715 1:232695116-232695138 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
923974672 1:239248673-239248695 TTTTATTTTGAGTAGAGACAGGG + Intergenic
1062808853 10:447169-447191 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808892 10:447369-447391 TGTGATCCTGAGTATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808966 10:447767-447789 TGTGATCCTGAGTATAGACGGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809020 10:448067-448089 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809093 10:448466-448488 TGTGATCCTGAGTATAGACGGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1062809149 10:448768-448790 TGTGATCCTGAGTATCGACAGGG - Intronic
1062809214 10:449168-449190 TGTGATCCTGAGTATTGACAGGG - Intronic
1062907055 10:1186322-1186344 TGAGACTCTGAGCAGAGACAGGG - Intronic
1063236566 10:4122961-4122983 TTTGATTCGAAGTAGAGACAAGG - Intergenic
1063254464 10:4310929-4310951 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1063379973 10:5578250-5578272 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1063474666 10:6317943-6317965 GGTGATTCTCAGGAGGAACAGGG + Intergenic
1064070378 10:12223792-12223814 TTTGCTTCTGAGTAAAGACAAGG + Intronic
1064128519 10:12686494-12686516 TGTTATTTTTAGTAGAGACAGGG + Intronic
1064498121 10:15937408-15937430 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1064625917 10:17261093-17261115 TGTATTTTTTAGTAGGGACAGGG + Intergenic
1064705959 10:18072875-18072897 TGTAATTTTTAGTAGAGACAGGG - Intergenic
1064787001 10:18909016-18909038 GGTGATTCTGAGAAGTGAGATGG + Intergenic
1064872427 10:19953290-19953312 TGTGATTCAGAATAGGGACGTGG + Intronic
1065010905 10:21419868-21419890 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1065165281 10:22970270-22970292 AGTGGTTCTGAGAAGGAACAGGG + Intronic
1065212812 10:23420986-23421008 TTTTATTTTTAGTAGGGACAGGG + Intergenic
1066246258 10:33586032-33586054 TGTGTATTTTAGTAGGGACAGGG + Intergenic
1066345923 10:34586776-34586798 TTTTATTTTTAGTAGGGACAGGG - Intronic
1066384758 10:34932665-34932687 TTGCATTTTGAGTAGGGACAGGG + Intergenic
1067727824 10:48785032-48785054 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1068427167 10:56881599-56881621 TCTGATTCTGAATTGGGACTTGG + Intergenic
1068898951 10:62242800-62242822 TTTGATTTTCAGTAGAGACAAGG + Intronic
1069201535 10:65623634-65623656 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1069436999 10:68393553-68393575 TGTTATTTTTAGTAGAGACAGGG - Intronic
1069444673 10:68462196-68462218 TGTGTTTGTGAGTAGAGACAGGG - Intronic
1069563839 10:69450436-69450458 TGTATTTCTTAGTAGAGACAGGG + Intergenic
1069614128 10:69795808-69795830 TATGATTCTGTGTATTGACAGGG - Intergenic
1069673218 10:70228130-70228152 TGTGCTTTTGAGCTGGGACAGGG + Intronic
1069708848 10:70476473-70476495 CGCTATTCTGAGTAGGGACTTGG + Intergenic
1069828175 10:71266865-71266887 TGTGATTCTGAGTAGCATGATGG + Intronic
1070226597 10:74514996-74515018 TGTGGTTTTTAGTAGAGACAGGG + Intronic
1070269728 10:74941255-74941277 TGTTATTCTGAATAGTCACATGG + Intronic
1071572399 10:86704886-86704908 TTTGTTTCTTAGTAGAGACAAGG + Intronic
1072021419 10:91407231-91407253 TGGTATTTTTAGTAGGGACAGGG + Intergenic
1072097907 10:92200370-92200392 TGTATTTCTTAGTAGAGACAGGG - Intronic
1072194847 10:93108541-93108563 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1072984349 10:100126886-100126908 TGTAGTTCTTAGTAGAGACAGGG + Intergenic
1073158185 10:101365647-101365669 TGTGATTTTTATTAGAGACAGGG + Intronic
1073622216 10:105061467-105061489 TGTATTTCTTAGTAGAGACAGGG + Intronic
1073760456 10:106623416-106623438 TTTGATTTTTAGTAGAGACAGGG + Intronic
1073840631 10:107495228-107495250 TGTGTTTCTTAGTATAGACAGGG - Intergenic
1074344499 10:112670028-112670050 TATGATTCTGAGTTGGGAGTCGG - Intronic
1074576994 10:114679460-114679482 TGTAATTTTTAGTAGAGACAAGG - Intronic
1075311271 10:121415803-121415825 TTTGATTTTTAGTAGAGACAAGG - Intergenic
1076703535 10:132287623-132287645 TGTGATTTTTAGTAGAGACGGGG + Intronic
1077092085 11:783291-783313 TGTTATTTTTAGTAGGGACGGGG - Intronic
1077483333 11:2826738-2826760 TGGGATTCTGAGTGGAGGCAGGG - Intronic
1078212184 11:9278849-9278871 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1078630425 11:12998367-12998389 TGGGATTTTTAGTAGAGACAGGG + Intergenic
1080265825 11:30400939-30400961 TTTGATTTTTAGTAGAGACAAGG + Intronic
1080911457 11:36603747-36603769 TTGTATTCTGAGTAGAGACAGGG - Intronic
1080913255 11:36627171-36627193 TGTGGTTGGGAGTAGGAACAGGG + Intronic
1081325019 11:41733932-41733954 TATGATACTTAGTAGGGACCAGG - Intergenic
1081412050 11:42771086-42771108 TGTGATTCTGAGTTGGGAACAGG + Intergenic
1081663162 11:44900865-44900887 TGTTATTTTTAGTAGAGACAGGG + Intronic
1081900835 11:46626420-46626442 TCTTATTTTGAGTAGAGACAGGG + Intronic
1082032660 11:47616854-47616876 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1082797621 11:57389359-57389381 TGTGGTTCTGGGGAGGAACAAGG - Intronic
1083199820 11:61113840-61113862 TGTTATTTTTAGTAGAGACAGGG + Intronic
1083451881 11:62751758-62751780 TTTGATTTTTAGTAGAGACAGGG - Exonic
1083570194 11:63756499-63756521 TTTTATTCTTAGTAGAGACAAGG - Intronic
1084076356 11:66780752-66780774 TTTGATTTTTAGTAGAGACAGGG + Intronic
1084867711 11:72073184-72073206 TTTGATTTTTAGTAGAGACAAGG - Intronic
1084990590 11:72920565-72920587 TGTTATTTTTAGTAGAGACAAGG - Intronic
1085097355 11:73772220-73772242 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1085227083 11:74931495-74931517 TTTTATTTTTAGTAGGGACAAGG + Intronic
1085539298 11:77252234-77252256 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1085598935 11:77837307-77837329 TGTTATTTTTAGTAGAGACAGGG + Intronic
1086089177 11:82987968-82987990 TGTGTTTCTGGTTAGGGAGAGGG + Intronic
1086396512 11:86421482-86421504 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1087166133 11:95005172-95005194 TATTATTCTTAGTAGAGACAGGG + Intergenic
1087755729 11:102053053-102053075 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1087789812 11:102394033-102394055 TTTGTTTCTGAGTAGAAACAGGG - Intergenic
1087793059 11:102427662-102427684 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1088400655 11:109420288-109420310 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1088728157 11:112657524-112657546 TGTGATGCTGAGGAAGGTCAGGG - Intergenic
1089527233 11:119105464-119105486 TGTTATTTTTAGTAGAGACAGGG - Intronic
1089957752 11:122587755-122587777 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1090013562 11:123065244-123065266 TGTTATTTTTAGTAGGGACGGGG + Intergenic
1090378557 11:126308932-126308954 TGGGGTTCTGAGTGGGAACAAGG - Intronic
1090797543 11:130147791-130147813 TGTGTTTTTTAGTAGAGACAAGG + Intergenic
1091032524 11:132203715-132203737 TGTTATTTTTAGTAGAGACAGGG - Intronic
1091428092 12:409029-409051 TGTTATTTTTAGTAGAGACAGGG - Intronic
1091620021 12:2080086-2080108 TGTTATTTTTAGTAGAGACAAGG - Intronic
1092105395 12:5918352-5918374 TGCCATTCTGCCTAGGGACAGGG + Intronic
1092358764 12:7818486-7818508 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1092969370 12:13677204-13677226 TTTGCTTCTTAGCAGGGACATGG - Intronic
1093258585 12:16904219-16904241 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1094547109 12:31414939-31414961 TTTGATTTTTAGTAGAGACAGGG - Intronic
1095755880 12:45766686-45766708 TGTATTTTTTAGTAGGGACAGGG + Intronic
1095805400 12:46313544-46313566 TTTTATTTTTAGTAGGGACAGGG + Intergenic
1095968602 12:47885588-47885610 TGTGACTCTGAGAAGGACCATGG + Intronic
1096130929 12:49158284-49158306 TTGGATTTTGAGTAGAGACAGGG - Intergenic
1096283565 12:50278101-50278123 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1096746889 12:53734810-53734832 TGTTATTTTTAGTAGAGACACGG + Intergenic
1096817234 12:54209266-54209288 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1096945103 12:55396956-55396978 TGTGACTCTGACTAGGTATAAGG + Intergenic
1097215171 12:57405459-57405481 TGTTATTTTTAGTAGAGACAAGG - Intronic
1097651195 12:62298982-62299004 TGTGATTCTTAATGGGTACAAGG - Intronic
1098070145 12:66665178-66665200 TGTAATTTTGTGTAGAGACAAGG + Intronic
1098335822 12:69403402-69403424 TGGTATTTTTAGTAGGGACAGGG - Intergenic
1098340566 12:69446615-69446637 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1099556526 12:84115114-84115136 TGTGATTCTGTGGATGGTCATGG + Intergenic
1099902941 12:88735139-88735161 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1100552641 12:95660185-95660207 TGTTATTTTTAGTAGAGACAGGG + Intronic
1100689077 12:97019429-97019451 TTTTATTTTCAGTAGGGACAGGG - Intergenic
1101136809 12:101752249-101752271 TGTTATTTTTAGTAGAGACAGGG - Intronic
1101619644 12:106372511-106372533 TTTTATTTTTAGTAGGGACAGGG + Intronic
1101778542 12:107815487-107815509 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1102259139 12:111433177-111433199 TTTGATTTTTAGTAGAGACAGGG - Intronic
1102284639 12:111645814-111645836 TTTGATTTTGTGTAGAGACAGGG - Intronic
1102291355 12:111702919-111702941 TTTGATTTTTAGTAGAGACAAGG - Intronic
1102354779 12:112223590-112223612 TTGTATTCTGAGTAGAGACAGGG + Intronic
1102367881 12:112355151-112355173 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1102404572 12:112662032-112662054 TCAGAATCTCAGTAGGGACAAGG + Intronic
1102574942 12:113850275-113850297 TCAAATTCTGAGTAGGGCCAAGG - Intronic
1102670661 12:114616188-114616210 TGTGTGTGTGTGTAGGGACAGGG - Intergenic
1102776910 12:115527860-115527882 TTTTATTCTTAGTAGAGACAGGG + Intergenic
1102814693 12:115855390-115855412 TTTGATTTTTAGTAGGGACGAGG - Intergenic
1103138748 12:118530392-118530414 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1103416743 12:120747180-120747202 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1103514352 12:121497476-121497498 TGTTATTTTTAGTAGAGACAGGG + Intronic
1103516398 12:121511180-121511202 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1103604597 12:122077806-122077828 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1103654209 12:122457374-122457396 TGTTATTGTTAGTAGAGACAGGG - Intergenic
1103670815 12:122613793-122613815 CAGGATTCTGAGTAGGGGCAGGG - Intronic
1103690768 12:122772908-122772930 TTTGATTTTTAGTAGAGACAGGG + Intergenic
1103727039 12:123003137-123003159 TGTGCTTTTGTGGAGGGACAGGG - Intronic
1104014922 12:124955480-124955502 TTTGATTTTTAGTAGAGACAGGG + Intronic
1104194607 12:126522292-126522314 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1104463962 12:128975622-128975644 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1104840399 12:131821854-131821876 TTTTATTTTTAGTAGGGACAAGG - Intergenic
1105342751 13:19543223-19543245 TGTAATTTTTAGTAGAGACAAGG + Intergenic
1105452887 13:20516312-20516334 GATGATTCTGAGTGGGGACAAGG + Intronic
1106223158 13:27764363-27764385 TGTTATTTTGAGTAGAGAGAGGG + Intergenic
1106526973 13:30549565-30549587 TGTGTGTGTGTGTAGGGACAGGG + Intronic
1106781404 13:33062204-33062226 TGTGATTTTTAGTAGAGACAAGG - Intronic
1106852798 13:33813194-33813216 TTTTATTCTTAGTAGAGACAGGG + Intergenic
1106902934 13:34373823-34373845 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1107337232 13:39368155-39368177 TGTAATTCTTAGTAGAGACAGGG - Intronic
1107341583 13:39412748-39412770 TTTAATTTTTAGTAGGGACAGGG - Intronic
1107356693 13:39574897-39574919 TTTGATTTTTAGTAGAGACAGGG - Intronic
1107870322 13:44740302-44740324 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1108041915 13:46347231-46347253 TGTTATTTTTAGTAGAGACAAGG - Intronic
1108955927 13:56156743-56156765 TTTGATTTTTAGTAGAGACAAGG - Intergenic
1109163991 13:59010732-59010754 TGAGATTTTGGATAGGGACACGG - Intergenic
1110000353 13:70190395-70190417 TGTGATACTAAGTAGTGACGTGG + Intergenic
1110237704 13:73233738-73233760 TTTTATTCTTAGTAGAGACAGGG + Intergenic
1110432717 13:75443749-75443771 TGTGATTCTGAGTAGGGACAGGG - Intronic
1110776155 13:79410589-79410611 TGTGATTCTAAGTAGAGTAATGG - Intergenic
1112265420 13:97919347-97919369 TGAGATTTTGGGTGGGGACATGG - Intergenic
1112662149 13:101522172-101522194 TGTGACTGTAAGTAGAGACAAGG - Intronic
1112772298 13:102804484-102804506 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1112888700 13:104206185-104206207 TTTGATTTTTAGTAGAGACAAGG - Intergenic
1113646649 13:112002202-112002224 TGTATTTTTTAGTAGGGACAGGG + Intergenic
1113971661 13:114195895-114195917 TGTAATTTTTAGTAGAGACAGGG - Intergenic
1113993991 14:16052358-16052380 TGGTATTTTGAGTAGAGACAGGG + Intergenic
1114485756 14:23060683-23060705 TGTTATTTTTAGTAGAGACAGGG + Intronic
1114816732 14:25967890-25967912 TTTTATTCTGAGTAAGGTCAGGG + Intergenic
1115439561 14:33417016-33417038 TATGATTCTTATTAGGGAAACGG + Intronic
1116287584 14:42992232-42992254 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1116856741 14:49959255-49959277 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1117122718 14:52585659-52585681 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1117173745 14:53127902-53127924 TGAGATTTTGGGTGGGGACATGG - Intronic
1117272167 14:54155798-54155820 TCAAATTCTGAGTAGAGACAGGG + Intergenic
1117687565 14:58270019-58270041 TTTGTTTCTTAGTAGAGACAGGG + Intronic
1117794159 14:59374664-59374686 TGTGATGCTGAGCAAGGACACGG + Intergenic
1118221451 14:63858292-63858314 TTTGATTTTTAGTAGAGACAGGG + Intronic
1118820481 14:69342273-69342295 TTTGATTTTTAGTAGAGACAAGG - Intronic
1119211735 14:72837041-72837063 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1119240521 14:73055875-73055897 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1119246938 14:73118301-73118323 TGTGCTTTTTAGTAGAGACAGGG - Intronic
1119816915 14:77577723-77577745 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1120760057 14:88276695-88276717 TGTGACTCTGAGCAGAGAGAAGG - Intronic
1121351326 14:93175574-93175596 TGTCATTGTTTGTAGGGACAGGG - Intergenic
1121648779 14:95540061-95540083 TTTTATTTTTAGTAGGGACAGGG + Intronic
1121763949 14:96469346-96469368 TGTATTTTTTAGTAGGGACAGGG - Intronic
1122151386 14:99727922-99727944 TGTATTTTTAAGTAGGGACAGGG - Intergenic
1122726622 14:103759130-103759152 TGTTATTTTTAGTAGGGACAGGG + Intronic
1122752705 14:103950260-103950282 TGTTATTTTTAGTAGAGACAGGG + Intronic
1123059673 14:105588838-105588860 TGAGACTCTGACCAGGGACAGGG - Intergenic
1123083997 14:105709087-105709109 TGAGACTCTGACCAGGGACAGGG - Intergenic
1123461096 15:20472505-20472527 TGTATTTTTGAGTAGAGACATGG - Intergenic
1123656963 15:22527875-22527897 TGTATTTTTGAGTAGAGACATGG + Intergenic
1123968138 15:25479484-25479506 TGTGATGCTGAGCAGAAACAGGG + Intergenic
1124035946 15:26053803-26053825 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1124086328 15:26553745-26553767 TGTGCTCCTGACTAAGGACAGGG - Intronic
1124271739 15:28288351-28288373 TGTATTTTTGAGTAGAGACATGG - Intronic
1124310875 15:28623051-28623073 TGTATTTTTGAGTAGAGACATGG + Intergenic
1124495526 15:30184409-30184431 TGTGCTCCAGAGCAGGGACAGGG + Intergenic
1124580683 15:30952242-30952264 TGTGATGCTGAGTAGCAGCAGGG - Intronic
1124644713 15:31429906-31429928 TGTTATTTTTAGTAGTGACAGGG + Intronic
1124748047 15:32354237-32354259 TGTGCTCCAGAGCAGGGACAGGG - Intergenic
1124814702 15:32978027-32978049 TTTTATTCTTAGTAGAGACAGGG + Intronic
1125139111 15:36383014-36383036 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1126276350 15:46886742-46886764 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1126301441 15:47201568-47201590 TTTGAGACAGAGTAGGGACAGGG + Intronic
1126616124 15:50582131-50582153 TTTGATTTTTAGTAGAGACAGGG + Intronic
1126754315 15:51910401-51910423 TTTGATTTTTAGTAGAGACAGGG - Exonic
1127241969 15:57126056-57126078 TGTTATTTTTAGTAGGGACGTGG - Intronic
1127479410 15:59364730-59364752 TTTTATTTTTAGTAGGGACAGGG - Intronic
1128144482 15:65325126-65325148 TGGGACTCTTAGAAGGGACAGGG + Intergenic
1128734054 15:70042310-70042332 TGTGATACCCTGTAGGGACAAGG + Intergenic
1128787604 15:70409841-70409863 TGGTATTTTTAGTAGGGACAGGG + Intergenic
1128818894 15:70634576-70634598 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1129430246 15:75495538-75495560 TGTTATTTTTAGTAGAGACATGG - Intronic
1129434616 15:75528564-75528586 TGTTATTTTTAGTAGAGACAAGG + Intronic
1129562226 15:76583176-76583198 TTTAATTTTTAGTAGGGACAGGG - Intronic
1129855710 15:78823300-78823322 TTTGATTTTGTGTAGAGACAGGG - Intronic
1129973770 15:79803912-79803934 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1130250285 15:82295881-82295903 TGTGTGTCTGTGTAGCGACAAGG + Intergenic
1130290095 15:82591436-82591458 TGTAATTTTTAGTAGAGACAGGG + Intronic
1130717194 15:86346521-86346543 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1131011526 15:89021999-89022021 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1131418133 15:92278502-92278524 TTTGATTTTTAGTAGAGACAGGG - Intergenic
1131807584 15:96138490-96138512 TGAGATTTTGAGTGGGGACACGG + Intergenic
1131835515 15:96386634-96386656 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1131909913 15:97187113-97187135 TGTATTTCTCAGTAGAGACAGGG + Intergenic
1132102462 15:99034277-99034299 TTTTATTTTTAGTAGGGACAGGG + Intergenic
1133266043 16:4584704-4584726 TTTTATTTTGAGTAGAGACAGGG + Intronic
1133560815 16:6948552-6948574 TTTGATTTTTAGTAGAGACAGGG + Intronic
1133615149 16:7469234-7469256 TTTAATTCTTAGTAGAGACAGGG + Intronic
1133753861 16:8746551-8746573 TGGTATTTTGAGTAGAGACAGGG + Intronic
1133759486 16:8786905-8786927 TTTTATTCTTAGTAGAGACAGGG - Intronic
1133762919 16:8814146-8814168 TGTGATTTTTAGTACAGACAGGG + Intronic
1134028027 16:10969518-10969540 TGTAATTCTTTGTAGAGACAGGG + Intronic
1134342976 16:13362189-13362211 TGTCGTTCTTAGTAGAGACAAGG - Intergenic
1134487076 16:14667162-14667184 TATTATTTTAAGTAGGGACAAGG - Intronic
1134601103 16:15534378-15534400 TGTATTTCTTAGTAGAGACAGGG - Intronic
1134603258 16:15550111-15550133 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1134771023 16:16809599-16809621 TTTGTTTCTTAGTAGAGACAGGG - Intergenic
1135017744 16:18938227-18938249 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1135027890 16:19012987-19013009 TGTAATTTTTAGTAGAGACAGGG + Intronic
1135079109 16:19418899-19418921 TATGATTTTTAGTAGAGACAAGG + Intronic
1135882942 16:26276794-26276816 TTTGTTTTTGAGTAGGGGCAGGG - Intergenic
1136585417 16:31181085-31181107 TGTGTTTCTTAGTAGGGGCGGGG + Intronic
1137453811 16:48602678-48602700 TGTAATACTGGGTAGTGACATGG - Intronic
1138083008 16:54109502-54109524 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1138396309 16:56707378-56707400 TTTGATTTTTAGTAGAGACAGGG + Intronic
1138415030 16:56866778-56866800 TGTATTTCTTAGTAGAGACAGGG + Intronic
1139618864 16:68120403-68120425 TGTTATTTTTAGTAGAGACAGGG - Intronic
1139747378 16:69085749-69085771 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1140288504 16:73627742-73627764 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1141448972 16:84084129-84084151 TGTAATTTTTAGTAGAGACAGGG + Intronic
1141596945 16:85103073-85103095 TGTATTTTTTAGTAGGGACAGGG + Intronic
1141851272 16:86647740-86647762 TGTGATTCTGTGGGGTGACAGGG + Intergenic
1142392815 16:89813604-89813626 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1142557059 17:786447-786469 TGTTATTTTTAGTAGAGACAGGG + Intronic
1142732421 17:1869362-1869384 TGTGATTTTTAGTAGAGACAGGG - Intronic
1142855811 17:2729316-2729338 TGTATTTCTTAGTAGAGACAGGG - Intergenic
1142892435 17:2952976-2952998 TGTTATTTTTAGTAGAGACAGGG + Intronic
1143446224 17:7011630-7011652 TGTAATTTTTAGTAGAGACAGGG + Intronic
1143616571 17:8054759-8054781 TTTTATTTTGAGTAGAGACAGGG + Intergenic
1144223645 17:13123125-13123147 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1144274187 17:13649206-13649228 TTTAATTCTGGGTAGGGACAGGG + Intergenic
1144439859 17:15271892-15271914 TGTGATTCTGAGTAAGGAGCTGG + Intergenic
1144520740 17:15950916-15950938 AGAGACTCTGAGTAAGGACATGG - Intronic
1144858964 17:18287822-18287844 TGTTATTTTTAGTAGAGACAGGG - Intronic
1145791297 17:27629034-27629056 TTTGATTTTTAGTAGAGACAAGG + Intronic
1145946154 17:28776196-28776218 TTGGATTTTTAGTAGGGACAGGG - Intronic
1146169053 17:30618770-30618792 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1146170509 17:30628679-30628701 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1146343963 17:32044702-32044724 TGTTATTTTTAGTAGAGACAGGG - Intronic
1146391457 17:32427273-32427295 TGGTATTCTTAGTAGAGACAAGG + Intergenic
1146551295 17:33782552-33782574 TGTGTTTTTTAGTAGAGACAAGG - Intronic
1147646205 17:42035723-42035745 TGTTATTTTTAGTAGAGACAGGG + Intronic
1148169331 17:45506058-45506080 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1148706567 17:49638837-49638859 TGTTATTTTTAGTAGAGACAGGG - Intronic
1148834343 17:50457901-50457923 TGTGATTCTGATGTGGGACTGGG - Intronic
1149025971 17:52027702-52027724 TCTGATTCTGAGTAGGGGTGAGG - Intronic
1149736572 17:59000425-59000447 TGTAATTTTTAGTAGAGACAGGG - Intronic
1149810536 17:59665664-59665686 TGTTATTTTTAGTAGAGACAGGG - Intronic
1149825167 17:59821722-59821744 TTTTATTTTTAGTAGGGACAGGG + Intronic
1149956160 17:61052888-61052910 TTTTATTTTTAGTAGGGACAGGG + Intronic
1150241069 17:63633053-63633075 TGTGTTTTTTAGTAGGGACAGGG - Intronic
1150400518 17:64852518-64852540 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1150843646 17:68633224-68633246 TTTGATTTTTAGTAGAGACAGGG + Intergenic
1151071622 17:71220005-71220027 TGTATTTCTTAGTAGAGACAGGG - Intergenic
1151263521 17:72936022-72936044 TGTATTTTTCAGTAGGGACAGGG - Intronic
1151444679 17:74155537-74155559 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1151466882 17:74291334-74291356 TGTTATTTTTAGTAGAGACAGGG + Intronic
1151994738 17:77601419-77601441 TGTCATTCTGAGTGGTGACCTGG - Intergenic
1152564289 17:81093222-81093244 TGCGATTCTGAGCAGGGGCCCGG - Intronic
1152872135 17:82761134-82761156 TTGTATTCTGAGTAGAGACAGGG + Intronic
1153022829 18:646921-646943 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1153533362 18:6072664-6072686 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1153777329 18:8465517-8465539 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1154356694 18:13627095-13627117 TGTATTTTTGAGTAGAGACAAGG - Intronic
1155957280 18:31964549-31964571 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1155966391 18:32039220-32039242 TTTGATTTTTAGTAGAGACAAGG - Intronic
1156340961 18:36210420-36210442 TGTGCTTCTTAGTAGTGTCAGGG - Intronic
1157379044 18:47194314-47194336 TGTGGTTCTGCTTAGGGTCATGG - Intergenic
1157757965 18:50235391-50235413 TGTAATTTTTAGTAGAGACAGGG - Intronic
1157847825 18:51019789-51019811 TTTTATTTTGAGTAGAGACAGGG - Intronic
1157848247 18:51024152-51024174 TGTAATTTTTAGTAGAGACAGGG + Intronic
1159036512 18:63283626-63283648 TGTGGTTCTGGGTTGGGATACGG - Intronic
1160012654 18:75117611-75117633 TGAGATTCAGGATAGGGACATGG + Intergenic
1160109486 18:76012586-76012608 TGAGATTTTGGGTGGGGACACGG - Intergenic
1161024847 19:2031911-2031933 TTTGACTCTTAGTAGAGACAGGG + Intronic
1161092689 19:2370243-2370265 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1161097026 19:2398119-2398141 TGTATTTTTTAGTAGGGACAGGG - Intronic
1161147551 19:2688076-2688098 TGTTATTTTTAGTAGGGACGGGG - Intronic
1161212148 19:3072595-3072617 TTTTATTCTTAGTAGAGACAGGG + Intergenic
1161549592 19:4904485-4904507 TGTTATTTTTAGTAGAGACAGGG + Intronic
1161693442 19:5751348-5751370 TGTATTTTTTAGTAGGGACAGGG - Intronic
1161860658 19:6795855-6795877 TGTTATTTTTAGTAGAGACAGGG + Intronic
1161914056 19:7215739-7215761 TGTAATTTTTAGTAGAGACAGGG + Intronic
1162010932 19:7814491-7814513 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1162420628 19:10564286-10564308 TGGGATTTTTAGTAGAGACAGGG - Intronic
1162651430 19:12091846-12091868 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1162662391 19:12180813-12180835 TGTGATGCTGACTTTGGACATGG + Intronic
1163247753 19:16107794-16107816 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1163682172 19:18689117-18689139 TGTATTTTTGAGTAGAGACAGGG + Intronic
1164141454 19:22469968-22469990 TGTGATTATTTGTAAGGACAGGG + Intronic
1164189002 19:22898375-22898397 TGTGTTTCTTAGTAGAGACGGGG + Intergenic
1164400290 19:27897425-27897447 TGAGAGTCTGAGTAGGGAGGTGG + Intergenic
1164414417 19:28034494-28034516 TGTATTTTTTAGTAGGGACAGGG - Intergenic
1164759003 19:30713981-30714003 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1165176577 19:33934841-33934863 TGTGATTCTGAGTGGGGCTAGGG + Intergenic
1165566486 19:36733593-36733615 TTTAATTTTTAGTAGGGACAAGG - Intronic
1165705426 19:37972954-37972976 TGTGATCCTGATTAGTTACATGG + Intronic
1165710951 19:38010536-38010558 TGTTATTTTTAGTAGAGACAGGG - Intronic
1165904056 19:39182643-39182665 TGTTATTTTTAGTAGAGACAGGG - Intronic
1165982806 19:39738892-39738914 TTTGACTCTGGGTATGGACATGG + Intergenic
1166160133 19:40946524-40946546 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1166684392 19:44787217-44787239 TGTTATTTTCAGTAGAGACAGGG - Intronic
1166701986 19:44887469-44887491 TGTAATTTTTAGTAGAGACAGGG - Intronic
1166770477 19:45278775-45278797 TGTTATTTTTAGTAGAGACAGGG + Intronic
1166820380 19:45575776-45575798 TTTTATTTTTAGTAGGGACAAGG + Intronic
1166825893 19:45608745-45608767 TGTATTTTTTAGTAGGGACAGGG + Intronic
1166830509 19:45636772-45636794 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1167337061 19:48893193-48893215 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1167375204 19:49107578-49107600 GGTGAATCTGGGCAGGGACAGGG - Intronic
1167409442 19:49336381-49336403 TGTATTTTTGAGTAGAGACAGGG - Intronic
1167438497 19:49494345-49494367 TTTTATTTTTAGTAGGGACAAGG - Intergenic
1167538352 19:50069783-50069805 TGTAATTTTTAGTAGAGACAGGG - Intergenic
1168109216 19:54182156-54182178 TGTGATTCACAGAAGGGACCGGG + Intronic
1168299655 19:55396752-55396774 TTTGATTTTTAGTAGAGACAGGG + Intronic
1168560157 19:57375477-57375499 TGTTATTCTTAGTAGAGACGGGG - Intronic
924998504 2:385463-385485 TCTGACTCTCAGGAGGGACAGGG - Intergenic
926310505 2:11671650-11671672 TGTTATTTTTAGTAGAGACAGGG + Intergenic
926318028 2:11725697-11725719 TTTGTTTCTGAGTTGGGAAAAGG + Intronic
927364465 2:22277767-22277789 TGTGATTTAGAGTAGGAACTAGG + Intergenic
927639886 2:24839782-24839804 TGTGACCCTGATGAGGGACAGGG - Intronic
928937992 2:36700567-36700589 TTTAATTTTTAGTAGGGACAAGG - Intronic
929066321 2:37978651-37978673 TGTTATTTTTAGTAGAGACAAGG - Intronic
929246089 2:39705369-39705391 TGTGACTCTGAAAAGGCACAAGG - Intronic
929499693 2:42479836-42479858 TGTTATTTTTAGTAGAGACAGGG - Intronic
929711593 2:44272143-44272165 TGTATTTTTGAGTAGAGACAGGG + Intergenic
930389446 2:50742432-50742454 TGTTATTTTTAGTAGAGACAGGG - Intronic
930656195 2:54009384-54009406 TGTGTTTTTAAGTAGAGACAGGG - Intronic
931349207 2:61472608-61472630 TTTTATTTTTAGTAGGGACAGGG + Intergenic
931983352 2:67718152-67718174 TGTGAGTCTGAGCAGGGAACTGG - Intergenic
931990819 2:67788405-67788427 TATGCTTGTGTGTAGGGACAGGG - Intergenic
932850538 2:75180205-75180227 TGTAATTTTGAGTACCGACAAGG - Intronic
933114149 2:78445723-78445745 TTTTATTTTGAGTAGAGACAGGG + Intergenic
933480185 2:82846756-82846778 TGTAATTTTTAGTAGAGACATGG - Intergenic
933492913 2:83010867-83010889 TGAGCTTCAGAGAAGGGACATGG + Intergenic
933665525 2:84961428-84961450 TGTTATTTTTAGTAGAGACAGGG + Intergenic
934480051 2:94629573-94629595 TGTGATTATGACAAGGAACAAGG + Intergenic
935349468 2:102141346-102141368 GGTGATTCTGAGTGGAGTCAAGG + Intronic
935610537 2:105019685-105019707 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
935965768 2:108473977-108473999 TTTGATTTTTAGTAGAGACAGGG - Intronic
936838454 2:116739060-116739082 TGTGATTCTAATTAGAGAAATGG + Intergenic
936955883 2:118021841-118021863 TGTGATTGTGAGTAGAGAGTAGG - Intergenic
937383599 2:121405134-121405156 TTTTATTTTTAGTAGGGACAGGG - Intronic
938393319 2:130922195-130922217 TGTGGTTTTTAGTAGAGACAGGG - Intronic
938859886 2:135357272-135357294 TGTTATTTTTAGTAGAGACAGGG + Intronic
939021324 2:136961392-136961414 TGTATTTCTTAGTAGAGACAGGG + Intronic
939580564 2:143941228-143941250 AGTGATTCTCAGGAGGGCCAGGG + Exonic
941109666 2:161405218-161405240 TGTGATACTTAGTAGTAACAGGG - Intronic
941816942 2:169804954-169804976 TGTTATTTTTAGTAGAGACAGGG - Intronic
942588440 2:177513015-177513037 TTTGATTTTTAGTAGAGACAAGG + Intronic
942599588 2:177627208-177627230 TGTGTTTTTTAGTAGAGACAGGG + Exonic
943009092 2:182424745-182424767 TATGATTGTGATTAGGGAAAAGG - Intronic
943032676 2:182704026-182704048 TGTAATTTTTAGTAGAGACAGGG - Intergenic
944093173 2:195936199-195936221 TGGTATTTTTAGTAGGGACAGGG - Intronic
944241577 2:197490654-197490676 TGTTATTTTCAGTAGAGACAGGG - Intronic
944670434 2:201989879-201989901 TGTATTTTTTAGTAGGGACAGGG + Intergenic
944920758 2:204410759-204410781 TGGGATTCAGTGTAGGCACAGGG + Intergenic
945011868 2:205472815-205472837 TGTGGTTCTGAGAAGTGAGAAGG + Intronic
945218664 2:207462589-207462611 TGTAATTTTTAGTAGAGACAGGG - Intergenic
946281683 2:218670519-218670541 TGTGATTTTTAGTAGAGACGGGG - Intronic
948265470 2:236632543-236632565 TGTGTTCCTGAGGAGGGAGATGG + Intergenic
948542383 2:238699806-238699828 CGTGACTCTGCGTATGGACAAGG - Intergenic
948932486 2:241141105-241141127 TTTTATTTTTAGTAGGGACAGGG - Intronic
948972221 2:241437979-241438001 TGTGTTTTTTAGTAGAGACATGG + Intronic
1168837908 20:890109-890131 TCTGACCCTGAGTAGGGTCAAGG - Intronic
1169044752 20:2526289-2526311 TTTGATTTTTAGTAGAGACAGGG + Intergenic
1169226546 20:3860545-3860567 TGTTATTTTTAGTAGAGACAGGG + Intronic
1169592329 20:7158765-7158787 TGTATTTCTTAGTAGAGACAGGG - Intergenic
1169710295 20:8553826-8553848 TTTGATTTTTAGTAGAGACAGGG - Intronic
1169953547 20:11075462-11075484 TTTGATTTTTAGTAGAGACAAGG - Intergenic
1170041080 20:12040033-12040055 TGTATTTCTTAGTAGAGACATGG - Intergenic
1170582259 20:17708027-17708049 TTTGATTTTTAGTAGAGACAGGG - Intronic
1171086855 20:22245517-22245539 TCTGATACTGAGTGGGAACATGG - Intergenic
1172064894 20:32212436-32212458 TTTGATTTTTAGTAGGGACAAGG + Intronic
1172365945 20:34349546-34349568 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1172741708 20:37173728-37173750 AGGGATTCTGAGGAGGGAAAGGG - Intronic
1173490233 20:43473791-43473813 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1173980793 20:47222359-47222381 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1173994316 20:47326130-47326152 TGTATTTCTTAGTAGAGACAGGG + Intronic
1174028344 20:47598507-47598529 TGTTATTTTTAGTAGAGACAGGG + Intronic
1175222826 20:57427060-57427082 TGTGATGGTCAGTAGGGACCCGG - Intergenic
1175620737 20:60444965-60444987 TTTGGTGCTTAGTAGGGACAGGG - Intergenic
1176160861 20:63647440-63647462 TGTTATTTTTAGTAGAGACAGGG - Intronic
1177039771 21:16094151-16094173 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1177169273 21:17637827-17637849 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1178074848 21:29005562-29005584 TGTGTTTTTTAGTAGAGACAGGG - Exonic
1178595024 21:33945531-33945553 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1178872889 21:36390826-36390848 TTTGATTTTTAGTAGAGACAAGG + Intronic
1179199523 21:39203579-39203601 TGTAATTTTTAGTAGAGACAAGG + Intronic
1179349124 21:40590948-40590970 TGAGATTTTGGGTGGGGACACGG - Intronic
1179526939 21:41985183-41985205 TGTGATTCTCAGTAAGCCCAAGG - Intergenic
1179663265 21:42892077-42892099 TGTAATTTTTAGTAGAGACAGGG - Intronic
1179970362 21:44833509-44833531 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1180211762 21:46299138-46299160 TGTATTTCTTAGTAGAGACAGGG + Intergenic
1180313277 22:11255157-11255179 TGGTATTTTGAGTAGAGACAGGG - Intergenic
1181941217 22:26478854-26478876 TGGGATTTTTAGTAGAGACAGGG + Intronic
1182068249 22:27445294-27445316 TTTTATTCTTAGTAGAGACAGGG - Intergenic
1182245434 22:28953840-28953862 TGTGCTTCAGAATAGGGACCTGG + Intronic
1182775036 22:32824783-32824805 TTTGATACTGAGTAAAGACATGG + Intronic
1182948407 22:34347609-34347631 TGTGATTTTTAGTAGAGACGGGG + Intergenic
1183187802 22:36302340-36302362 TTTGATTTTTAGTAGAGACAAGG - Intronic
1183498924 22:38166553-38166575 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1183583801 22:38740553-38740575 TGTGAACCTGAGAAGGGGCAAGG + Intronic
1183859578 22:40660135-40660157 TGTGCTTTTTAGTAGAGACAGGG + Intergenic
1183988195 22:41580805-41580827 TGTATTTTTTAGTAGGGACAGGG - Intronic
1184036073 22:41918893-41918915 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1184141960 22:42582903-42582925 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1184202418 22:42980339-42980361 TTTGATTTTTAGTAGAGACAAGG - Intronic
1184400042 22:44268474-44268496 AGTGAGGCTGAGGAGGGACACGG + Intronic
1184980540 22:48092336-48092358 TGTTATTATTAGTAGAGACAGGG - Intergenic
949349884 3:3114573-3114595 TGTGTTTTTTAGTAGAGACAGGG - Intronic
949630187 3:5918052-5918074 TTTGATTTTTAGTAGAGACAGGG + Intergenic
950070158 3:10145529-10145551 TGTTATTTTCAGTAGAGACAGGG - Intronic
950652758 3:14417555-14417577 TGTGTTTTTTAGTAGAGACAGGG - Intronic
951397284 3:22184651-22184673 TGTGTTTGTAAGTAGAGACAGGG - Intronic
951691563 3:25401948-25401970 TGTTATTTTTAGTAGAGACAGGG + Intronic
952167191 3:30763324-30763346 TGTTATTTTTAGTAGCGACAGGG - Intronic
952392135 3:32889761-32889783 TGTTATTTTTAGTAGAGACAGGG + Intronic
952928023 3:38336105-38336127 TTTGATTTTGGGTAGAGACAGGG + Intergenic
953166150 3:40466496-40466518 TTTGATTTTTAGTAGAGACAGGG - Intergenic
953332402 3:42064876-42064898 TGTTATTTTTAGTAGAGACAGGG - Intronic
953402061 3:42632241-42632263 TGTTATTTTTAGTAGAGACATGG + Intronic
954117879 3:48477266-48477288 TGTTATTTTTAGTAGAGACAGGG + Intronic
954159559 3:48711081-48711103 TGTTATTTTTAGTAGAGACAAGG + Intronic
954192027 3:48970062-48970084 TGTGTTTTTTAGTAGAGACAGGG + Intronic
955376318 3:58400208-58400230 GGTGATTCCTAGTAGGGACCCGG + Intronic
956114205 3:65902523-65902545 TGTGATTCTTAGGAGGGCCAGGG - Intronic
956766718 3:72490571-72490593 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
956827909 3:73015938-73015960 TGTTTTTTTGAGTAGAGACAGGG + Intronic
956841414 3:73143604-73143626 AGGGATTCTGAGTTGGCACAAGG - Intergenic
957005202 3:74937369-74937391 TGTGTTTTTCAGTAGAGACAAGG - Intergenic
957166117 3:76676129-76676151 TGAGATTTTGGGTGGGGACATGG - Intronic
958692781 3:97489509-97489531 TGTGTTTTTTAGTAGAGACAGGG - Intronic
959079701 3:101787048-101787070 AGTGATTCTCAGTAGAGACGGGG - Intronic
959269191 3:104184244-104184266 TTTTATTCTTAGTAGAGACAGGG - Intergenic
960223281 3:115142486-115142508 TGTTATTTTTAGTAGAGACAGGG - Intronic
960346107 3:116535382-116535404 TGTGTTTTTAAGTAGGGAAAGGG - Intronic
960482932 3:118215286-118215308 TGTGAATCTAAGAATGGACAGGG - Intergenic
960795280 3:121479623-121479645 TTTGATTTTTAGTAGAGACAGGG + Intronic
962064173 3:131961869-131961891 TCTGGATCTGAGTAGGGAAAAGG - Intronic
962213438 3:133498971-133498993 TGTATTTTTGAGTAGAGACAGGG + Intergenic
963213213 3:142717079-142717101 TGTTATTTTTAGTAGAGACAGGG - Intergenic
963812687 3:149794704-149794726 TGTCATTTTTAGTAGAGACAGGG - Intronic
963885091 3:150572680-150572702 TGTTATTTTTAGTAGGGACGGGG - Intronic
964510903 3:157450227-157450249 TTTGATTTTTAGTAGGGACGAGG + Intronic
964656000 3:159066765-159066787 TATGTTTCTGAGGAGAGACATGG + Intronic
964899617 3:161642578-161642600 TGTATTTCTTAGTAGAGACAGGG + Intergenic
965170098 3:165251859-165251881 TTTGATTTTTAGTAGAGACAGGG + Intergenic
965231947 3:166065578-166065600 TTTTATTTTTAGTAGGGACAGGG + Intergenic
966510328 3:180755184-180755206 TGTTATTTTCAGTAGAGACACGG - Intronic
966536070 3:181035622-181035644 GGTGTTTCTGTGAAGGGACAGGG - Intergenic
966598386 3:181748812-181748834 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
966970496 3:185041028-185041050 TGTGTTTTTCAGTAGAGACAGGG - Intronic
968065300 3:195755366-195755388 TTTGATTTTTAGTAGAGACAGGG + Intronic
968317822 3:197739111-197739133 TGTATTTTTTAGTAGGGACAAGG + Intronic
968576648 4:1369326-1369348 TGTGAAGCTGAGTGGGGCCAGGG - Intronic
968795455 4:2700786-2700808 TGTTATTTTTAGTAGAGACAGGG - Intronic
969366639 4:6698928-6698950 TGTAATTTTTAGTAGAGACAGGG + Intergenic
970846227 4:20541304-20541326 TGTGATTCTGAGTAAGAATGGGG + Intronic
971226245 4:24754182-24754204 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
971290594 4:25335272-25335294 TTTTATTTTTAGTAGGGACAGGG - Intronic
971544588 4:27869458-27869480 TTTTATTCTTAGTAGAGACAGGG + Intergenic
971796084 4:31230067-31230089 TGTAATTTTTAGTAGCGACACGG - Intergenic
972006547 4:34115319-34115341 TGTGTGTCTGTGTAGAGACAGGG - Intergenic
972496851 4:39642157-39642179 TGTATTTTTTAGTAGGGACAGGG + Intergenic
972533415 4:39980062-39980084 TGTTATTTTTAGTAGAGACAGGG + Intergenic
974929279 4:68343372-68343394 TGTTATTTTTAGTAGAGACAGGG + Intronic
975967685 4:79994580-79994602 TGTAATTCTCAGGAGGAACAGGG - Intronic
976190794 4:82484820-82484842 TGTGAATATGTGTAGGGACGTGG - Exonic
976400105 4:84597463-84597485 TGTTATTTTTTGTAGGGACAGGG - Intronic
976470175 4:85419050-85419072 TGTGATGCTGAGAAAGGAAAGGG + Intergenic
976626293 4:87186650-87186672 TGTATTTTTCAGTAGGGACAGGG + Intronic
976726148 4:88217486-88217508 TGTAATTTTTAGTAGAGACAGGG - Intronic
976801166 4:88993824-88993846 TGTTATTTTTAGTAGAGACAGGG - Intronic
976922805 4:90458525-90458547 TTTTATTTTGAGTAGAGACAGGG + Intronic
977329669 4:95621765-95621787 TGGGACCCTGAGTAGTGACATGG - Intergenic
977461017 4:97325314-97325336 TGTGTGTATCAGTAGGGACATGG - Intronic
978502120 4:109420673-109420695 TGTTATTTTGAGTAGCGACCGGG + Intergenic
978530410 4:109706732-109706754 TGTTATTTTTAGTAGAGACAGGG - Intergenic
978675913 4:111315962-111315984 TGTCCTTCTTTGTAGGGACATGG - Intergenic
979083115 4:116368306-116368328 TGTAATTTTTAGTAGAGACAAGG - Intergenic
979513857 4:121584587-121584609 TGTGCTTCTGAGAATGGAGATGG + Intergenic
980056153 4:128081906-128081928 TGTGTTTTTTAGTAGAGACAGGG + Intronic
980127828 4:128790421-128790443 TTTGATTTTGTGTAGAGACAGGG + Intergenic
980268227 4:130547896-130547918 TTTGATTTTTAGTAGAGACAAGG - Intergenic
980407509 4:132372306-132372328 TGTGTTTGTGAGTAGAGAAAAGG - Intergenic
981399255 4:144293803-144293825 TGTGGTTTAGTGTAGGGACATGG + Intergenic
981731871 4:147908014-147908036 TGTAATTTTTAGTAGAGACAGGG + Intronic
982145679 4:152387880-152387902 TGTTATTTTTAGTAGAGACAGGG + Intronic
982970886 4:161984858-161984880 AGTGGTTCTGACTAGGGCCAAGG - Intronic
983683455 4:170379707-170379729 TTTGATTTTTAGTAGAGACAGGG - Intergenic
983860139 4:172695771-172695793 TGTAATTTTTAGTAGAGACAGGG - Intronic
984693272 4:182753118-182753140 TGTGTTTTTTAGTAGAGACAGGG + Intronic
985187811 4:187336497-187336519 TGTGATTGTGACAATGGACAAGG - Intergenic
985379781 4:189381069-189381091 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
986329940 5:6710615-6710637 TGTCTTTCTGAGAAGAGACATGG + Intergenic
986682308 5:10245244-10245266 TTTGATTTTTAGTAGAGACAGGG - Intronic
987068977 5:14317952-14317974 TTGTATTCTGAGTAGAGACACGG - Intronic
987138516 5:14921761-14921783 TTTGATTTTTAGTAGAGACAGGG - Intergenic
987330014 5:16848330-16848352 TGTTATTTTTAGTAGAGACAGGG + Intronic
987387128 5:17340597-17340619 TGTGAATAAGATTAGGGACATGG + Intergenic
987454760 5:18129749-18129771 TGTGATTCTGGGTTGGGGCAGGG + Intergenic
987785972 5:22499083-22499105 TTGGATTTTTAGTAGGGACAGGG + Intronic
988128260 5:27072063-27072085 TGTGACTGTGTCTAGGGACAAGG - Intronic
988916779 5:35902422-35902444 TGTGATTCTGAGCAAGGACCAGG - Intergenic
989111061 5:37906976-37906998 TGTGGTTTTGAGCAGGGTCAGGG + Intergenic
989780250 5:45256196-45256218 TGTAATTTTTAGTAGAGACAGGG - Intergenic
990631734 5:57677735-57677757 TGTAATTTTTAGTAGAGACAGGG - Intergenic
992436452 5:76759950-76759972 TGTTATTTTTAGTAGAGACAGGG - Intergenic
992449216 5:76860604-76860626 GCTGATGCTGAGGAGGGACAGGG + Intronic
992846343 5:80752749-80752771 TGTAATTATTAGTAGGGAAAGGG + Intronic
992895907 5:81245023-81245045 TGTTATTTTTAGTAGAGACAGGG + Intronic
992992743 5:82301072-82301094 TGTGTTTTTTAGTAGAGACAGGG - Intronic
995149784 5:108829463-108829485 TTTGATTTTTAGTAGAGACAAGG - Intronic
996216016 5:120867296-120867318 TTTGATTTTTAGTAGAGACAGGG + Intergenic
996370965 5:122752126-122752148 TGTAATTTTTAGTAGAGACAGGG - Intergenic
997480719 5:134182694-134182716 TGTTATTTTTAGTAGAGACAGGG + Intronic
997547285 5:134719517-134719539 TGGTATTTTGAGTAGAGACAGGG - Intronic
997928207 5:138050263-138050285 TTTTATTTTTAGTAGGGACAGGG - Intronic
997968834 5:138383774-138383796 TGTGTTTTTTAGTAGAGACAGGG - Intronic
998258025 5:140604219-140604241 TTTGATTTTTAGTAGAGACAAGG - Intergenic
999044709 5:148454612-148454634 TGTGATTCTGATAAGGGAGAAGG - Intronic
999114243 5:149148604-149148626 TGTGATACAGAGTAGGGATGCGG - Intronic
999808429 5:155105713-155105735 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1000359348 5:160433123-160433145 TGCCATTCTCAGGAGGGACAGGG - Intergenic
1000755408 5:165152650-165152672 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1000945398 5:167417073-167417095 GGTGATTAAGATTAGGGACATGG - Intronic
1001102642 5:168826934-168826956 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1001112661 5:168910567-168910589 TGTAATTTTTAGTAGAGACAGGG - Intronic
1001276594 5:170355752-170355774 TGGGATTCTGAGCAGAGAGAGGG - Intronic
1001482673 5:172099365-172099387 TGTTATTTTTAGTAGAGACAGGG - Intronic
1001515214 5:172350646-172350668 TGTGATTCCCAGTAGGAGCAAGG - Intronic
1001813727 5:174650279-174650301 TGTAATTCTTAGTAGAGACGGGG + Intergenic
1001996206 5:176161215-176161237 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1002033101 5:176445448-176445470 TTTTATTTTTAGTAGGGACAGGG + Intergenic
1002385733 5:178865439-178865461 TGTTATTTTTAGTAGAGACAGGG + Intronic
1002387721 5:178881014-178881036 TGTTATTTTTAGTAGAGACAGGG + Intronic
1003003119 6:2355543-2355565 TGTGTTTCTGAGTTAGGACGAGG + Intergenic
1003167931 6:3697595-3697617 AGTGATGCTCAGTAGGGACTAGG + Intergenic
1003725361 6:8756270-8756292 TTGGATTCTTAGTAGAGACAGGG - Intergenic
1003756805 6:9130528-9130550 TGTATTTTTGAGTAGAGACAGGG - Intergenic
1004046165 6:12025865-12025887 TTTTATTTTTAGTAGGGACAGGG - Intronic
1004606357 6:17198627-17198649 TGTGATTTTTAGTAGAGACAGGG + Intergenic
1004615275 6:17282433-17282455 TCTGAGGCTGAGTAGGGACCTGG + Intronic
1004968396 6:20880427-20880449 TGTATTTTTTAGTAGGGACAGGG + Intronic
1005230037 6:23689400-23689422 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1005650891 6:27884043-27884065 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1006141071 6:31930251-31930273 TTCTATTCTTAGTAGGGACAGGG + Intronic
1006656489 6:35598393-35598415 TGTTATTTTTAGTAGAGACAGGG + Intronic
1006665982 6:35693691-35693713 TTTTATTTTTAGTAGGGACAGGG + Intronic
1008109122 6:47473567-47473589 TGGAATTCTCAGTAAGGACAAGG - Intergenic
1008257256 6:49318681-49318703 TGGGATTAGGAGTAGGGATAGGG + Intergenic
1008927417 6:56901421-56901443 TTTGATTTTTAGTAGAGACAGGG - Intronic
1009423007 6:63484338-63484360 TTTGATTTTTAGTAGAGACAGGG - Intergenic
1009674830 6:66805130-66805152 TGTAATTCTTAGTACAGACAGGG - Intergenic
1010142340 6:72625583-72625605 TGTGGTTCTGAGAAGTTACATGG + Intronic
1010248990 6:73688940-73688962 TTTGATTTTTAGTAGAGACAAGG + Intergenic
1010351754 6:74883195-74883217 TGTGTTCCAGAGGAGGGACAAGG - Intergenic
1010404258 6:75484799-75484821 TCTGATTGTGAGCAGGCACAGGG - Intronic
1010431803 6:75786097-75786119 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1010737977 6:79464438-79464460 AGTGCTTCTGTGTAGGTACAGGG - Intergenic
1010758428 6:79694138-79694160 TGTGATTTTAATTAGGGCCATGG + Intronic
1011009674 6:82689675-82689697 TGTTATTTTGAGTAGAGAGACGG - Intergenic
1011025168 6:82860803-82860825 TGTTATTCTGTGTTAGGACACGG + Intergenic
1011572443 6:88753830-88753852 TGAGCTTCTTACTAGGGACAGGG + Intronic
1012045772 6:94271279-94271301 TATGATTCTACCTAGGGACAGGG + Intergenic
1013019663 6:106200652-106200674 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1013194798 6:107835565-107835587 TTTGATTTTTAGTAGAGACAAGG - Intergenic
1013529497 6:111005976-111005998 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1013729063 6:113141429-113141451 TGTGTTCCTGAGTAGGCATAAGG + Intergenic
1014193273 6:118522703-118522725 TGTATTTTTTAGTAGGGACAGGG - Intronic
1014510323 6:122313015-122313037 TGTGATGCTGAGTGGGAAGATGG + Intergenic
1014645599 6:123968848-123968870 TGTGACTCTGAGGAGGGTGAAGG - Intronic
1014764602 6:125392287-125392309 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1014795196 6:125716817-125716839 TTTGATTTTCAGTAGAGACATGG + Intergenic
1014931968 6:127345819-127345841 TGTGATTTTTTGTAGAGACAGGG - Intergenic
1015585325 6:134770447-134770469 TGTAATTTTTAGTAGAGACAGGG - Intergenic
1015646010 6:135389134-135389156 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1015947112 6:138514142-138514164 TGTTATTTTTAGTAGAGACAGGG - Intronic
1016010999 6:139136806-139136828 TGTTATTTTTAGTAGAGACAGGG + Intronic
1016019878 6:139226124-139226146 TGGTATTCTTAGTAGAGACAGGG - Intergenic
1016187252 6:141212111-141212133 GGTGGTACTGAGTAGGGGCAAGG + Intergenic
1016298376 6:142601004-142601026 GGTGATTCTGAGTTTGGCCATGG + Intergenic
1016327686 6:142921664-142921686 TGTAATCCTCAGTAGGGATAGGG - Intronic
1016942518 6:149494830-149494852 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1017088023 6:150732757-150732779 TGTGTTTTTTAGTAGCGACACGG + Intronic
1017507516 6:155082169-155082191 TTTTATTTTGTGTAGGGACAAGG - Intronic
1017550467 6:155500778-155500800 TGTGATTCTTAGTGGAGAAAAGG - Intergenic
1017724289 6:157266101-157266123 TGTGATTTTGATTTGGGACAGGG + Intergenic
1018701367 6:166430140-166430162 TGTTATTTTTAGTAGAGACAGGG + Intronic
1018758023 6:166866403-166866425 TTTTATTCTTAGTAGGGACAGGG - Intronic
1019325884 7:438069-438091 TGTGATTCTCAGAAGGAACTGGG - Intergenic
1019345867 7:530640-530662 TGTGTTTTTCAGTAGAGACAGGG + Intergenic
1019595407 7:1856197-1856219 CGTGCCTCTGAATAGGGACATGG + Intronic
1019655475 7:2192302-2192324 TGTTATTTTTAGTAGAGACAGGG + Intronic
1019770587 7:2881711-2881733 TTGTATTTTGAGTAGGGACAGGG + Intergenic
1019971981 7:4548798-4548820 TGTGATTCTTAGTAAGGAGGTGG - Intergenic
1019985917 7:4655569-4655591 TTTTATTCTTTGTAGGGACAGGG - Intergenic
1020250266 7:6462242-6462264 TTTGAATCTGAGCATGGACATGG + Exonic
1020554226 7:9650614-9650636 TGTGATTTTTTGTAGAGACAGGG + Intergenic
1021497925 7:21297005-21297027 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1021564180 7:22000554-22000576 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1022582337 7:31567951-31567973 TTTGAATCTTAGTAGAGACAGGG - Intronic
1022669226 7:32440275-32440297 TTTGATTTTTAGTAGAGACAAGG - Intergenic
1023012475 7:35936473-35936495 TTTTATTCTTAGTAGAGACAGGG - Intergenic
1023815234 7:43944228-43944250 TGTTATTTTTAGTAGAGACAGGG + Intronic
1024106809 7:46097317-46097339 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1024266254 7:47609163-47609185 TTTGTTTCTTAGTAGAGACAGGG + Intergenic
1024336340 7:48210373-48210395 TGAGATTTTGGGTGGGGACATGG + Intronic
1024638839 7:51313302-51313324 TGTGACTCTTGGTAGTGACATGG - Intronic
1025732085 7:64116078-64116100 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1025773555 7:64536894-64536916 TTTGATTATTTGTAGGGACAGGG - Intronic
1026309198 7:69169009-69169031 TTTGATATTGAGTAGAGACAAGG - Intergenic
1026623009 7:71967453-71967475 TTTGATTTTTAGTAGAGACAAGG - Intronic
1026675097 7:72421760-72421782 TGTAATTTTTAGTAGAGACAGGG + Intronic
1026744011 7:72997245-72997267 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1026804261 7:73419850-73419872 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1027030119 7:74881940-74881962 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1027099726 7:75367837-75367859 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1027256778 7:76435896-76435918 TGTATTTCTTAGTAGAGACAGGG + Intronic
1027282072 7:76616108-76616130 TGTATTTCTTAGTAGAGACAGGG - Intronic
1027379432 7:77590734-77590756 TGTATTTTTGAGTAGAGACAAGG + Intronic
1027432902 7:78132846-78132868 TGTGATTCTGAGAGGTGATAGGG - Intronic
1028491559 7:91417991-91418013 TGTGATGCTGAGTGGCGACTTGG + Intergenic
1028582519 7:92422494-92422516 TGTGCTTCTGAGCAGGGTCTAGG + Intergenic
1028804221 7:95006389-95006411 TGTTATTTTTAGTAGAGACAGGG + Intronic
1029171574 7:98633283-98633305 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1029961861 7:104696122-104696144 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1030483255 7:110131252-110131274 AGTGATTGTGACTGGGGACAAGG - Intergenic
1030630660 7:111892372-111892394 TTTGATTTTTAGTAGAGACAGGG + Intronic
1032055425 7:128680737-128680759 TGTTATTTTTAGTAGAGACAGGG + Intronic
1032203609 7:129842256-129842278 TGTATTTTTTAGTAGGGACAGGG - Intronic
1032268535 7:130384520-130384542 TGCGATTCTGAGGAAGGAAATGG - Exonic
1032530694 7:132617226-132617248 GGTGCTTCTCAGTAGTGACAGGG + Intronic
1032575264 7:133046735-133046757 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1032848811 7:135774854-135774876 TTTGATTTTTAGTAGAGACAGGG + Intergenic
1033160970 7:138996389-138996411 TATGATTCTTAGTAGAGACGAGG - Intergenic
1033166170 7:139040451-139040473 TGTAATTTTGGGTAGAGACAGGG - Intergenic
1033337402 7:140465324-140465346 TGTTATTTTTAGTAGAGACAGGG - Intronic
1033526142 7:142215587-142215609 TTGGATTTTGAGTAGAGACAGGG - Intronic
1034156593 7:148960669-148960691 TGTAATTTTTAGTAGAGACAGGG - Intergenic
1034250852 7:149689484-149689506 TGTGACTCTGAGTAGAAACCAGG - Intergenic
1034738408 7:153450780-153450802 TCTGATTCTTAGAAAGGACAGGG + Intergenic
1036475264 8:9087433-9087455 TTTGATTTTTAGTAGAGACAGGG + Intronic
1037017261 8:13924243-13924265 TTTTATTCTTAGTAGAGACAGGG - Intergenic
1037833786 8:22204425-22204447 TGTAAATCTGAGTCGGGGCAGGG + Intronic
1037971111 8:23172629-23172651 TATGGTTTTTAGTAGGGACAGGG - Intergenic
1038058183 8:23881970-23881992 TGTATTTTTCAGTAGGGACAGGG + Intergenic
1038283804 8:26189466-26189488 TGTGTTTTTCAGTAGAGACAGGG - Intergenic
1039266109 8:35825759-35825781 TGTATTTTTTAGTAGGGACAGGG - Intergenic
1040647183 8:49412840-49412862 TTTTATTTTTAGTAGGGACAGGG - Intergenic
1040864688 8:52037191-52037213 TGTGTTTCTTAGTAGAGACTGGG + Intergenic
1041183904 8:55278160-55278182 TTCGATTTTTAGTAGGGACAGGG - Intronic
1041417757 8:57630982-57631004 TGTGTTTTTTAGTAGAGACAGGG + Intergenic
1041963658 8:63649195-63649217 TGTCTTTCTGAGTATGGAGAGGG + Intergenic
1042102299 8:65286501-65286523 TGTTATTTTTAGTAGAGACAAGG + Intergenic
1042146632 8:65736577-65736599 TTTTATTTTTAGTAGGGACAAGG - Intronic
1043355054 8:79402129-79402151 TGTGGCTCTGAGTAGAGAAATGG + Intergenic
1043614766 8:82112321-82112343 TGTAAATCTGGCTAGGGACAGGG - Intergenic
1043928824 8:86068097-86068119 ACTGAATCTGAGTAGGTACAGGG - Intronic
1044450488 8:92330482-92330504 TGTAATTTTTAGTAGAGACAGGG + Intergenic
1044593757 8:93939172-93939194 TTGTATTCTTAGTAGGGACAGGG + Intergenic
1045150405 8:99400842-99400864 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1045157075 8:99488670-99488692 TGTGTTACTGTGTAGGGACTGGG + Intronic
1045170554 8:99662872-99662894 TGTTATTTTTAGTAGAGACAGGG - Intronic
1045448550 8:102293974-102293996 TGTTATTCTGAGTGTGGAAATGG - Exonic
1045493675 8:102689944-102689966 TGTAATTTTTAGTAGAGACAGGG - Intergenic
1045941430 8:107743290-107743312 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1046653636 8:116869410-116869432 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1046996923 8:120534006-120534028 TGTAATTGTTAGTAGAGACAAGG - Intronic
1047091164 8:121577322-121577344 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1047249362 8:123170056-123170078 TGTATTTCTTAGTAGAGACAGGG + Intergenic
1047463097 8:125087555-125087577 TTTGATTTTTAGTAGAGACAAGG - Intronic
1047483776 8:125309549-125309571 TTTGATTTTTAGTAGAGACAGGG - Intronic
1047518368 8:125575108-125575130 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1047524626 8:125622236-125622258 TTTGATTTTTAGTAGAGACAGGG + Intergenic
1047730808 8:127726552-127726574 TGTCATTTTTAGTAGAGACAGGG + Intergenic
1048337305 8:133512634-133512656 TGTGAGTCTGAGTCCGCACAGGG + Intronic
1048998378 8:139808284-139808306 TGTACTTTTTAGTAGGGACAGGG - Intronic
1049664727 8:143837842-143837864 TGTGTCCCTGAGGAGGGACATGG - Intronic
1049864744 8:144927286-144927308 TGTGATTTTCAGTAGAGACAGGG - Intergenic
1049949901 9:633822-633844 TTTTATTTTTAGTAGGGACAGGG + Intronic
1050554409 9:6776775-6776797 TGTTATTTTTAGTAGAGACAGGG + Intronic
1050613554 9:7378278-7378300 TGAGATTTTTAGTAGAGACAGGG - Intergenic
1051110732 9:13632486-13632508 TTTGATTTTTAGTAGAGACAGGG - Intergenic
1051281383 9:15444917-15444939 TTTGATTTTTAGTAGAGACAAGG - Intronic
1052196897 9:25728126-25728148 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1052305639 9:27006423-27006445 TTTTATTTTGAGTAGAGACAAGG - Intronic
1052494120 9:29205212-29205234 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1053087486 9:35238728-35238750 TGTAATTTTTAGTAGAGACAGGG + Intronic
1053677788 9:40454228-40454250 TGTGATTATGACAAGGAACAAGG - Intergenic
1053927705 9:43082063-43082085 TGTGATTATGACAAGGAACAAGG - Intergenic
1054285938 9:63170727-63170749 TGTGATTATGACAAGGAACAAGG + Intergenic
1054290861 9:63289754-63289776 TGTGATTATGACAAGGAACAAGG - Intergenic
1054388882 9:64594301-64594323 TGTGATTATGACAAGGAACAAGG - Intergenic
1054506835 9:65922070-65922092 TGTGATTATGACAAGGAACAAGG + Intergenic
1055018120 9:71641135-71641157 TGTGTGTGTGTGTAGGGACAGGG - Intergenic
1055046796 9:71934694-71934716 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1055536246 9:77248390-77248412 TGTGATTTTTAGTAGAGACTGGG + Intronic
1055691045 9:78831080-78831102 TGTGATTCTGGCTGGGCACAGGG - Intergenic
1055894578 9:81160522-81160544 TTTGATTTTCAGTAGAGACAGGG - Intergenic
1056209552 9:84352710-84352732 TTTGATTTTTAGTAGAGACAGGG - Intergenic
1056645370 9:88407315-88407337 TGTTATTTTCAGTAGAGACAGGG + Intronic
1057032246 9:91784744-91784766 TGACATTTTGAGTAGGGCCAGGG - Intronic
1057358637 9:94353328-94353350 TTTGATTTTTAGTAGAGACAGGG - Intergenic
1057649114 9:96904282-96904304 TTTGATTTTTAGTAGAGACAGGG + Intronic
1057922742 9:99111452-99111474 TGTTATTTTTAGTAGAGACAGGG - Intronic
1058147586 9:101429329-101429351 TTTGATTTTTAGTAGAGACAAGG + Intronic
1058975291 9:110120675-110120697 TGTATTTTTGAGTAGAGACAAGG + Intronic
1059065070 9:111075184-111075206 TGTTATTTTTAGTAGAGACAGGG - Intergenic
1059293083 9:113245258-113245280 TGTTTTTCTTAGTAGAGACAAGG + Intronic
1059759353 9:117323562-117323584 AGTGATTCAGAGTAAGAACAGGG - Intronic
1060694786 9:125699380-125699402 TTTGATTTTTAGTAGAGACAAGG + Intronic
1060890985 9:127188234-127188256 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1061023749 9:128034146-128034168 TTTTATTTTTAGTAGGGACAGGG - Intergenic
1061025259 9:128044284-128044306 TTTTATTTTTAGTAGGGACAGGG - Intergenic
1061162865 9:128905668-128905690 TGTGTTTTTTAGTAGAGACAAGG - Intronic
1061197699 9:129116701-129116723 TGTTATTTTTAGTAGAGACAGGG + Intronic
1061209069 9:129180351-129180373 TGTGATTTTTAGTAGAGACAGGG - Intergenic
1061478973 9:130887052-130887074 TGTGACTCTGGGCAGGGACCCGG + Intronic
1061829635 9:133283047-133283069 TCTGATTTTTAGTAGAGACAGGG + Intergenic
1062166779 9:135111887-135111909 TGTGTTTTTTAGTAGAGACAGGG + Intronic
1062451019 9:136615858-136615880 TGTGACTCTGGGGAGGGACAAGG + Intergenic
1062492942 9:136816540-136816562 TGTTATTTTTAGTAGAGACAGGG - Intronic
1185582711 X:1223378-1223400 TGTGATTCTGAGGGCTGACAGGG + Intergenic
1185738253 X:2509803-2509825 TGTAGTTCTTAGTAGAGACAGGG - Intergenic
1185811041 X:3110722-3110744 TGTATTTCTTAGTAGAGACAGGG - Intronic
1186009543 X:5114316-5114338 TGTGTTTTTTAGTAGAGACAAGG + Intergenic
1186063529 X:5737444-5737466 TGGGAGTCTGAGGAGGCACAGGG + Intergenic
1186509868 X:10122763-10122785 GGTGATTCTGCGTAGGGAGAAGG - Intronic
1186840643 X:13481533-13481555 CGTGATTTTTAGTAGAGACAGGG - Intergenic
1186934613 X:14434386-14434408 TTTTATTCTTAGTAGAGACAAGG - Intergenic
1186999335 X:15159081-15159103 AGTGCTTCTCAGTAGGGACCAGG + Intergenic
1187150878 X:16680384-16680406 TGTTATTTTTAGTAGAGACAGGG - Intronic
1187866214 X:23725642-23725664 TTTGATTTTTAGTAGAGACAAGG - Intronic
1188409485 X:29853502-29853524 TGTGGTTCTAAGGAGAGACAGGG - Intronic
1188705105 X:33318617-33318639 TGTATTTCTTAGTAGAGACAGGG + Intronic
1189169044 X:38891339-38891361 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1190121636 X:47665003-47665025 TGTGATTCACACAAGGGACATGG - Intergenic
1190597358 X:52062658-52062680 TCTGATTCTGAGGAGGAAAAGGG + Exonic
1190611466 X:52191415-52191437 TCTGATTCTGAGGAGGAAAAGGG - Exonic
1190710045 X:53061044-53061066 TGTGTTTTTTAGTAGAGACAGGG - Intronic
1190749545 X:53349452-53349474 TGTGTTTTTTAGTAGAGACAGGG - Intergenic
1192256481 X:69465039-69465061 AGTGATGCTGAGTAGGGAGAAGG + Intergenic
1192502259 X:71661938-71661960 TGGAAGACTGAGTAGGGACATGG + Intergenic
1194427164 X:93753410-93753432 TGTAATTTTTAGTAGAGACAAGG - Intergenic
1194465609 X:94231437-94231459 TGTGTTTCTGATTAGGTACTTGG + Intergenic
1194745323 X:97621757-97621779 TGTGTGTCTGAGTGGGTACACGG - Intergenic
1196514595 X:116554790-116554812 TGTATTTTTGAGTAGAGACAAGG - Intergenic
1196535228 X:116836492-116836514 TGAGGTTCAGAGTTGGGACAGGG - Intergenic
1197355202 X:125430902-125430924 TGTTATTTTTAGTAGAGACAGGG + Intergenic
1197639091 X:128948283-128948305 TCTCATTATGAGTAGAGACAGGG - Intergenic
1197765496 X:130057143-130057165 TGTGAGTCTCAGAAGGGGCAGGG - Exonic
1197894309 X:131294769-131294791 TGTGATGCTGAGGAGGAACCAGG - Intronic
1198548135 X:137715649-137715671 TGTGATTTTTAGTAGAGACGGGG - Intergenic
1198574393 X:137994135-137994157 TGTGAGGCTGTGAAGGGACAGGG + Intergenic
1198738924 X:139820011-139820033 TGTTATTTTTAGTAGAGACAGGG - Intronic
1199209107 X:145185554-145185576 TGAGACTCTGAGAAGGGAAAGGG - Intergenic
1199523337 X:148763062-148763084 TGTTGTTTTGAGAAGGGACATGG - Intronic
1200140273 X:153897672-153897694 TGTGTTTTTCAGTAGAGACAGGG + Intronic
1200710874 Y:6483950-6483972 TGTATTTCTTAGTAGAGACAAGG - Intergenic
1201023060 Y:9678035-9678057 TGTATTTCTTAGTAGAGACAAGG + Intergenic
1201483203 Y:14463192-14463214 TGAGATTCTTTGCAGGGACATGG + Intergenic