ID: 1110434571

View in Genome Browser
Species Human (GRCh38)
Location 13:75464689-75464711
Sequence TTGTGCCAATGCAAGATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110434571_1110434576 15 Left 1110434571 13:75464689-75464711 CCCTTGATCTTGCATTGGCACAA 0: 1
1: 0
2: 1
3: 2
4: 98
Right 1110434576 13:75464727-75464749 CTGGAACCACTGTATGTCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 145
1110434571_1110434573 -4 Left 1110434571 13:75464689-75464711 CCCTTGATCTTGCATTGGCACAA 0: 1
1: 0
2: 1
3: 2
4: 98
Right 1110434573 13:75464708-75464730 ACAAACTGAGACACATTTCCTGG 0: 1
1: 0
2: 3
3: 13
4: 224
1110434571_1110434575 14 Left 1110434571 13:75464689-75464711 CCCTTGATCTTGCATTGGCACAA 0: 1
1: 0
2: 1
3: 2
4: 98
Right 1110434575 13:75464726-75464748 CCTGGAACCACTGTATGTCCAGG 0: 1
1: 0
2: 1
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110434571 Original CRISPR TTGTGCCAATGCAAGATCAA GGG (reversed) Intronic
902235280 1:15053389-15053411 TTGTCCTACTGCAAGAACAATGG - Intronic
904968132 1:34396220-34396242 TTGTTCCAGTCCAAGCTCAAAGG - Intergenic
910208269 1:84769412-84769434 TTGGGCCAATGAAATATAAATGG - Intergenic
910610056 1:89131565-89131587 ATGTGGAAATGCTAGATCAAAGG + Intronic
912406578 1:109443677-109443699 TTGAGCCAATGCAGGAGCAGAGG + Intergenic
917034396 1:170731220-170731242 TTTTGTCAGTGCAAGAACAACGG - Intronic
919543952 1:198888664-198888686 CTTTGGCATTGCAAGATCAAAGG - Intergenic
1064986721 10:21217787-21217809 TTGTGCCAAGCCAAAATAAATGG - Intergenic
1070375183 10:75823594-75823616 TAGTGGGATTGCAAGATCAAAGG - Intronic
1079954568 11:26846868-26846890 TTCTTCCAATGCAAAATCCATGG - Intergenic
1081475514 11:43426407-43426429 TATGGCCAATGCATGATCAAGGG - Intronic
1084189023 11:67490617-67490639 TTGTGCCAATGAAGCATGAATGG + Intronic
1084398238 11:68928939-68928961 TTTTGCCAATTGAAGATCAGAGG + Intronic
1088081907 11:105927623-105927645 TTGTTCCGATGGAAGGTCAAAGG - Intronic
1095254902 12:40023218-40023240 TTGTGCTAAGGCAGGATCATTGG - Intronic
1097951346 12:65432365-65432387 TTGTGGCAAGGAAAGATGAATGG + Intronic
1097984368 12:65768148-65768170 TTTTGCCCATGCAAGGTCCATGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1111796400 13:92926107-92926129 TTGTGCAAATGAGAGATAAAGGG + Intergenic
1113157823 13:107345184-107345206 GTCTTCCAATGCAAGAACAAAGG - Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1117947911 14:61049854-61049876 TTGTGAGAATGCAAGAACACTGG + Intronic
1118914992 14:70095368-70095390 TTGTGTCAATGCTAGGTCACTGG - Intronic
1119375839 14:74192087-74192109 ATCTTCCAATGCAAGATAAATGG - Intronic
1121398852 14:93653833-93653855 CTGTTCCAAAGCACGATCAAAGG + Exonic
1127900586 15:63338229-63338251 TTGTGCTTATGCAAGCTCCAAGG + Intronic
1129100925 15:73262984-73263006 TAGTGACAAAGCAAGATCAGTGG + Intronic
1134060199 16:11194947-11194969 TCGTGCCAAAGCAAGCTCAAGGG + Intergenic
1139265146 16:65631449-65631471 TTGTTACAATGCAAGATCAATGG - Intergenic
1147157160 17:38549744-38549766 GGGAGCCACTGCAAGATCAAAGG - Intronic
1150678327 17:67263977-67263999 GTGTTCCAACGCAAGATAAAAGG - Intergenic
1153841853 18:9014892-9014914 TTGCGCCATTCCAAGAGCAATGG + Intergenic
1155354449 18:24937797-24937819 TTTGGCCAATGCCAGATGAAGGG - Intergenic
1156023622 18:32627439-32627461 TGGTGCTATTGCAAGAACAATGG - Intergenic
1158274081 18:55747699-55747721 TTGTGGAAATGCAAAGTCAAAGG + Intergenic
1162057275 19:8072097-8072119 TGCTACGAATGCAAGATCAATGG - Exonic
1164036688 19:21462005-21462027 TTGTGCCTGTGGAAGATAAAAGG + Intronic
1164055394 19:21617887-21617909 TTGTGCCTAGGGAAGATAAAAGG - Intergenic
1165753288 19:38275029-38275051 TTGTGACATTGAAAGAGCAAAGG + Intronic
1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG + Exonic
926327129 2:11795094-11795116 TTATGCAAATGCTTGATCAAGGG - Intronic
929813271 2:45209916-45209938 TTGTAACATTGCAAGAGCAAAGG - Intergenic
931166319 2:59752898-59752920 TTGTTCCACTGGAAGGTCAATGG + Intergenic
935500894 2:103836999-103837021 TTGGTCCAATGCAAGAGGAAAGG + Intergenic
937099328 2:119256638-119256660 TTTTGCCACTGCAAGAGCAGGGG + Intronic
943786863 2:191886884-191886906 TTGTGGCAGTACAAGGTCAATGG + Intergenic
943814947 2:192241465-192241487 TAGTCCAAATGCAAAATCAATGG - Intergenic
945151196 2:206793793-206793815 TTGTGTCAATGAAAGAAAAATGG + Intergenic
947033232 2:225821895-225821917 TTGTGCAAATGGAAAAACAAAGG - Intergenic
1169949505 20:11027675-11027697 CTGAGCCAAAGCAAGATAAAGGG - Intergenic
1170065479 20:12305529-12305551 TTGTGGCAATGTAGCATCAAGGG - Intergenic
1181907103 22:26207231-26207253 TGGTGTCAAAGCAAGATGAATGG - Intronic
952877577 3:37959738-37959760 TTGTGGAAATGCTAGGTCAAAGG + Intronic
955675075 3:61439605-61439627 TTGTGCCAATTCCAGAGCTAGGG + Intergenic
961613219 3:128157599-128157621 TTGTGCCATTTCAAGAGCACAGG - Intronic
961938840 3:130615878-130615900 TCTTGCCAAAGCAAGATTAAAGG - Intronic
963908309 3:150792473-150792495 TTGTGAGAAGGCAAGATCAGGGG - Intergenic
974078745 4:57191838-57191860 TTGTCAAAATGCAACATCAAAGG + Intergenic
977757652 4:100692330-100692352 TTGTTCCAATGAAAGAAAAAAGG - Intronic
980837039 4:138207748-138207770 TTGTCAAAATGCAAGATAAAAGG + Intronic
983544986 4:168953460-168953482 TTGTGCCACTGCAAAGGCAACGG - Intronic
990416397 5:55591118-55591140 TTGTGCCAATGAGATATCAGGGG + Intergenic
992561276 5:77955379-77955401 TTTTGCCAATGCTATATCACTGG - Intergenic
995232809 5:109789090-109789112 CTTTGCTAATGCAAGAACAATGG - Intronic
995840983 5:116443011-116443033 TTTTGCCAAAGAAAAATCAAAGG + Intergenic
995892885 5:116975649-116975671 TTTTGCCAAAGCCAGATGAAAGG - Intergenic
997692586 5:135836830-135836852 TGGTGCCAATGCTAGATGCATGG - Intronic
997766445 5:136508464-136508486 TTGGGCCCATTCAAGAGCAATGG + Intergenic
997952819 5:138255535-138255557 TAGTACCATTGCCAGATCAAAGG - Intronic
1003925338 6:10872280-10872302 TTTTGGCAATGGAAGTTCAAAGG + Intronic
1005145041 6:22679880-22679902 TTTTGCCAATGAAAGAACCAGGG + Intergenic
1005149573 6:22733617-22733639 TCATGCCAATGAAAGAACAAAGG + Intergenic
1005863216 6:29917205-29917227 TTGTGCCTGTGGAAGATCACGGG - Intergenic
1006140082 6:31923272-31923294 TTTTGCCAATGGAATATGAATGG + Intronic
1007051290 6:38833004-38833026 TAGTGAGAATGCAAAATCAATGG - Intronic
1008004353 6:46394317-46394339 TTGTGCAAATGCCAAATCATAGG - Intronic
1010124317 6:72414442-72414464 TTATGACTATGAAAGATCAATGG + Intergenic
1010462376 6:76128069-76128091 TTGTGACAATGAAAGAAAAAAGG - Intergenic
1011798616 6:90983848-90983870 TTGTGCCAGTTAAAGATCACTGG - Intergenic
1012625870 6:101402617-101402639 TTGTCCCAACACAGGATCAAAGG - Intronic
1014612929 6:123567100-123567122 TTCAGTCAATGCAAGCTCAAGGG + Intronic
1018473123 6:164113772-164113794 TTTGGCCAATGAAAGAACAAAGG + Intergenic
1021350082 7:19581631-19581653 TTGTGTCAATGGAAGATGAGTGG + Intergenic
1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG + Intronic
1026358507 7:69581142-69581164 TTGTTCCAATCCAAGTCCAAGGG - Intergenic
1028434709 7:90789048-90789070 AAGTGCCATTGCAAGGTCAAAGG - Intronic
1030440638 7:109584222-109584244 GAGTGCCAAGCCAAGATCAATGG + Intergenic
1030853589 7:114522196-114522218 TTGTGCTAATGCAAAATGAAGGG + Intronic
1030925967 7:115454865-115454887 TTGAGCCAATGCAATATGATAGG + Intergenic
1032595633 7:133236783-133236805 TTGTGCCAGAGCAAGAACAGAGG - Intergenic
1033338402 7:140472686-140472708 TTGTAACAATGCAAAAACAAGGG - Intronic
1036154282 8:6327386-6327408 TAGTTCCAATCCAAGCTCAAAGG + Intergenic
1038029820 8:23628103-23628125 TTATTCCAATTCAAGCTCAAAGG + Intergenic
1038279513 8:26151262-26151284 TTGTACCAATGGAAAATAAAGGG - Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1043348234 8:79325318-79325340 CCGTACTAATGCAAGATCAAAGG - Intergenic
1044422767 8:92017147-92017169 TTCTGCAAATGAAAAATCAAGGG - Intronic
1046810633 8:118529345-118529367 TTGTGACAATGAAAGCCCAAAGG - Intronic
1048784194 8:138033241-138033263 GGGGGCCAGTGCAAGATCAAGGG - Intergenic
1186122661 X:6380790-6380812 TAGACCCAATTCAAGATCAAAGG - Intergenic
1194794093 X:98188506-98188528 TTTTGCCAAGACAAGATGAAAGG + Intergenic
1198245271 X:134824989-134825011 ATGTGCCAATGCAGGTTCATTGG + Intronic