ID: 1110434576

View in Genome Browser
Species Human (GRCh38)
Location 13:75464727-75464749
Sequence CTGGAACCACTGTATGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110434569_1110434576 26 Left 1110434569 13:75464678-75464700 CCTGGCAAATGCCCTTGATCTTG 0: 1
1: 0
2: 1
3: 14
4: 165
Right 1110434576 13:75464727-75464749 CTGGAACCACTGTATGTCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 145
1110434572_1110434576 14 Left 1110434572 13:75464690-75464712 CCTTGATCTTGCATTGGCACAAA 0: 1
1: 0
2: 0
3: 5
4: 134
Right 1110434576 13:75464727-75464749 CTGGAACCACTGTATGTCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 145
1110434571_1110434576 15 Left 1110434571 13:75464689-75464711 CCCTTGATCTTGCATTGGCACAA 0: 1
1: 0
2: 1
3: 2
4: 98
Right 1110434576 13:75464727-75464749 CTGGAACCACTGTATGTCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110434576 Original CRISPR CTGGAACCACTGTATGTCCA GGG Intronic
902202246 1:14842431-14842453 CTGGAGCCAATGTCAGTCCATGG + Intronic
903260700 1:22130235-22130257 CTGGAGCCGCTGTCTGCCCAGGG + Intronic
908792594 1:67797908-67797930 CTGGCACCACTGGATGACCACGG + Intronic
908982906 1:69979905-69979927 CTGTAACCCCTGTGTGTGCATGG + Intronic
909783196 1:79575285-79575307 CTGGAACAACTATATGCCAATGG - Intergenic
910244626 1:85125007-85125029 CTTTAACTACTGTATGTCCCTGG - Intronic
910782339 1:90953228-90953250 CTGAACCCACAGTATCTCCAAGG - Intronic
911563614 1:99435902-99435924 CTTGAATACCTGTATGTCCAAGG - Intergenic
913180941 1:116320666-116320688 CTGGATCCACTGTTGGTCGAGGG + Intergenic
915696591 1:157748874-157748896 CTGCAGCCAGTGTATGTCAATGG - Exonic
919179963 1:194067999-194068021 CTGTAACCACTATTTGTCAAAGG - Intergenic
919934578 1:202243178-202243200 CAGGAACCATCGTATTTCCAGGG + Intronic
1063380285 10:5580792-5580814 CTGGAACAGCTGAATATCCATGG - Intergenic
1072473737 10:95738244-95738266 CTGGAATCTCTGTGTGTGCATGG + Intronic
1074797013 10:116957215-116957237 TTGGAACCCCTCTATGTCTAAGG + Intronic
1075820064 10:125300155-125300177 CTGGAACAACTGGACATCCACGG + Intergenic
1079072182 11:17356852-17356874 CTGGAGCCATTGTGTCTCCATGG + Exonic
1080713993 11:34780343-34780365 CTGGAACTAATGTTTGTCTACGG + Intergenic
1081186122 11:40044444-40044466 CTGAACCCACAGTATCTCCAAGG - Intergenic
1081666443 11:44919671-44919693 CTGTCACCACTGTGTGACCATGG - Intronic
1083068065 11:59946063-59946085 AAGGGACCACTGCATGTCCATGG - Intergenic
1083854330 11:65385189-65385211 CAGGACACACTGTATCTCCATGG - Intergenic
1085206768 11:74738687-74738709 AAGGATCCACTGTATGTCCAGGG - Intergenic
1089390933 11:118101153-118101175 CTGGAAGCACTGTGTGCCCTGGG + Intronic
1090218066 11:124988219-124988241 CTGAACCCACAGTATCTCCAAGG - Intronic
1093236673 12:16617218-16617240 CTGGGACAACTGTATTTACATGG + Intergenic
1094303665 12:28994200-28994222 ATGAAACCACTGGATGTCCAGGG + Intergenic
1095077450 12:37948587-37948609 TTGGAACCACTGTTTTTCTAGGG - Intergenic
1095475856 12:42587055-42587077 ATGGAAGCACTATTTGTCCATGG - Intronic
1095596926 12:43969843-43969865 CTGGAAATACTGTATTTCCTTGG + Intronic
1099439083 12:82679843-82679865 CTGGAACAAATGAATATCCAAGG + Intergenic
1100775039 12:97964574-97964596 CTGGAACAACTGTAAGTTTAGGG - Intergenic
1102349982 12:112184901-112184923 GTGGAACCACAGCATGTCCTCGG + Exonic
1110434576 13:75464727-75464749 CTGGAACCACTGTATGTCCAGGG + Intronic
1112422095 13:99261685-99261707 CTGGAACCACTGAAGTCCCATGG + Exonic
1112603374 13:100879210-100879232 CTGGAAACACTGTTTGTCCCTGG + Intergenic
1116107569 14:40529743-40529765 CTAGAATCCCTGTATGTCTAAGG + Intergenic
1117263278 14:54058824-54058846 CTGAACCCACAGTATCTCCAAGG - Intergenic
1117575265 14:57091412-57091434 CTTGACCCACTGTATGAGCATGG + Intergenic
1118408588 14:65452256-65452278 CTGGAAACACTGTATTTTAAAGG - Intronic
1122005523 14:98700315-98700337 CTGGAAACTCTGTATTTGCAAGG + Intergenic
1122184630 14:99981577-99981599 GTGCACCCACTGTATCTCCAGGG - Intronic
1124487404 15:30131235-30131257 CTGGAACCATGGCGTGTCCATGG + Intergenic
1124500160 15:30221174-30221196 CTGAAAGGACTGTCTGTCCAGGG + Intergenic
1124542494 15:30600209-30600231 CTGGAACCATGGCGTGTCCATGG + Intergenic
1124743415 15:32317492-32317514 CTGAAAGGACTGTCTGTCCAGGG - Intergenic
1124756123 15:32407088-32407110 CTGGAACCATGGCGTGTCCATGG - Intergenic
1125505068 15:40263088-40263110 GGGGAACCACTGGCTGTCCAGGG + Intronic
1126665886 15:51076332-51076354 ATGGAACCACTCTGAGTCCAGGG + Intronic
1129898112 15:79123443-79123465 CTGGAGGCTCTTTATGTCCATGG + Intergenic
1138370934 16:56525822-56525844 CTGGCACCACTAGATATCCAGGG - Intergenic
1138401536 16:56748946-56748968 CTGGGGGCACTGTATTTCCAAGG - Intronic
1139276284 16:65730550-65730572 CTGTAAGCACTCTCTGTCCATGG + Intergenic
1142131147 16:88432057-88432079 CGGGAACCACTGTCCGTTCAGGG - Exonic
1142951004 17:3480065-3480087 CAGGAACCACTAGAGGTCCAGGG - Intronic
1143574984 17:7786936-7786958 CTCGATCCACAGTGTGTCCACGG - Exonic
1151727890 17:75895047-75895069 CTGTGACCTCTATATGTCCAAGG + Intronic
1203162920 17_GL000205v2_random:68263-68285 CTTGGACCACTGAATGGCCAAGG - Intergenic
1159899577 18:74033181-74033203 CTGGAATCACTTTATGACCTAGG + Intergenic
1162909985 19:13843256-13843278 CTGGAACCCCTGTTGGTCTAAGG + Intergenic
1165838334 19:38772613-38772635 CAGGAACCCCAGTATTTCCAGGG + Intronic
1165841225 19:38790084-38790106 CAGGAACCCCAGTATTTCCAGGG - Intronic
1166198610 19:41221973-41221995 CTGGAGCCAGAGTAGGTCCACGG - Exonic
1166214920 19:41328589-41328611 CAGGAATCTCTGTGTGTCCACGG + Intronic
930768972 2:55113047-55113069 CTGGAATCACAGTGTGGCCAGGG - Intergenic
932099293 2:68882213-68882235 CAAGAACCACTGTCTCTCCAAGG - Intergenic
932846903 2:75144486-75144508 GAGAAAGCACTGTATGTCCATGG - Intronic
933273157 2:80255328-80255350 ATGGAATCACTGTATTACCATGG - Intronic
934625485 2:95846608-95846630 CTTTAACCATTGTATGTCCTTGG - Intronic
934808089 2:97254712-97254734 CTTTAACCATTGTATGTCCTTGG + Intronic
934829421 2:97502475-97502497 CTTTAACCATTGTATGTCCTTGG - Intronic
935259236 2:101340704-101340726 CTGGAAACAATGTTTGTCCCAGG - Intergenic
936546722 2:113396228-113396250 CTTTAACCATTGTATGTCCTTGG + Intergenic
937724153 2:125140214-125140236 CAGAAACCACTGTTTGTTCAGGG - Intergenic
937824894 2:126357720-126357742 CTAGAACCACTGGCTGTCCTAGG + Intergenic
938790519 2:134671665-134671687 CTGTGACCACTGTCTTTCCAGGG - Intronic
940850829 2:158686782-158686804 CTGGAATCACTGGATGTGAATGG - Intergenic
945235716 2:207629594-207629616 CTGGAACTAGTCCATGTCCAAGG + Intergenic
947736145 2:232456514-232456536 CTGGAACCACTGAAGGTCCCGGG - Intronic
1170573338 20:17645064-17645086 CTGGAACCTCTGTAGGACCAGGG - Intronic
1170682177 20:18536162-18536184 CTGAACCCACAGTATTTCCAAGG - Intronic
1174303028 20:49595816-49595838 CTGGAACCCGTGAATGTACAAGG - Intergenic
1175877602 20:62237897-62237919 CTGGAGCCACTGTAGGTCAGTGG + Intronic
1176289480 21:5036525-5036547 CTGTCACCACTGTGCGTCCAAGG + Intronic
1178267431 21:31156753-31156775 CTGTTATCACTGTCTGTCCATGG - Intronic
1179867750 21:44227062-44227084 CTGTCACCACTGTGCGTCCAAGG - Intronic
1181024481 22:20120280-20120302 CTGAAACCACTGGGTGGCCATGG + Intronic
1181049828 22:20233232-20233254 TGGGATCCACTGTAAGTCCAGGG - Intergenic
1181776709 22:25165390-25165412 CTGGAAGCAGTGTTTGTTCAGGG + Intronic
951942310 3:28093042-28093064 CTGGGGCAACTGTATATCCATGG - Intergenic
952317712 3:32246066-32246088 CTGGAACAACTGTGAGGCCAAGG - Intronic
954115345 3:48464098-48464120 CTGGAGCCATTGTGTCTCCAAGG - Exonic
959357487 3:105351167-105351189 CTGGAAAGATTGTATGTGCAAGG + Intergenic
963834189 3:150039571-150039593 CTGGAATCACTTTCTGTCAAAGG + Intronic
964621193 3:158721487-158721509 GTGGAACCACTGAAGGTCTAAGG + Intronic
965516715 3:169629715-169629737 CTGGAACTACTGAATGGTCAGGG + Intronic
965760521 3:172070481-172070503 CCCAAACAACTGTATGTCCAGGG - Intronic
968286387 3:197511314-197511336 CTGGTACCTCTGCATGTCCATGG - Exonic
969625130 4:8298725-8298747 CTAGAACAACTGAATTTCCAAGG - Intronic
973563483 4:52161074-52161096 CTGAAAACACTGCATGTCCTGGG + Intergenic
975723524 4:77270521-77270543 CTGCAACCACTGGATGCCCCAGG - Intronic
979717316 4:123856034-123856056 GTGTAACCATTGTATGACCAGGG - Intergenic
982321009 4:154077719-154077741 GTGGCACAACTGTATTTCCAGGG - Intergenic
984341959 4:178468775-178468797 CTAAAACCACTGTATTTCTAAGG + Intergenic
986836695 5:11646917-11646939 CTGGAAGCACTGTGTGTGCAGGG - Intronic
987130776 5:14857878-14857900 CTGGAACAACTGTCTATACAGGG + Intronic
987278377 5:16386668-16386690 CTGGAGCCAATGTTTGTCCTGGG - Intergenic
988159651 5:27502984-27503006 ATGGAAACACTGGATGACCAGGG - Intergenic
988369592 5:30348962-30348984 ATGTAACCACTGTTTTTCCAAGG + Intergenic
990003914 5:50923382-50923404 CTGGAAACCCCGTATGTCCCAGG - Intergenic
992420849 5:76602976-76602998 CTGGGAACAGTGTATGCCCAAGG - Intronic
997261888 5:132471678-132471700 ATGGACCCACTGTGTGACCATGG + Intronic
1000232702 5:159330869-159330891 ATGGAACAACTGTATGCCCAAGG + Exonic
1005121861 6:22399043-22399065 CTTGAACCCGTGTATCTCCATGG - Intergenic
1006613077 6:35306959-35306981 CAGGAACCACTGTATGTAGCTGG - Intronic
1007207190 6:40162528-40162550 ATGGAACTACTGTTTGACCAGGG - Intergenic
1008023347 6:46605215-46605237 TTAGAACCCCTGAATGTCCATGG + Intronic
1009835550 6:68996595-68996617 CTGAAAGCACTGTATGTTCTTGG + Intronic
1011271158 6:85580898-85580920 CTGGAACCACCCCATATCCAGGG + Intronic
1012443372 6:99283466-99283488 CTGGAGCCAGTACATGTCCATGG - Intronic
1012925904 6:105267476-105267498 CTGGAACAACTGGAATTCCACGG + Intergenic
1013148559 6:107420601-107420623 CTGGAACAACTGGACATCCATGG + Intronic
1014312768 6:119825776-119825798 CTGGAAGCACTTTATGAACAAGG - Intergenic
1014962873 6:127708285-127708307 CTGGAAACACAGTATGTGAAAGG + Exonic
1016685819 6:146880991-146881013 CTGGAACTGCTGTCTTTCCATGG - Intergenic
1017806157 6:157947225-157947247 CTGCCACCACTAAATGTCCAAGG + Intergenic
1019866225 7:3712880-3712902 ATGGCACCACTGAAGGTCCAAGG - Intronic
1024054668 7:45652329-45652351 CTGGAACCACGGAATCTGCATGG - Intronic
1024891386 7:54208003-54208025 CTGAAAACACTGTGTCTCCACGG + Intergenic
1025591718 7:62868774-62868796 CTGGAAACACTGTTTGGGCAGGG + Intergenic
1026104342 7:67409324-67409346 CTGGAACCTCTGAAGGTCAAGGG + Intergenic
1031511438 7:122655665-122655687 CTGGACCCACAATATCTCCAAGG + Intronic
1031588949 7:123566504-123566526 CTGGAAAGGCTGTATTTCCATGG - Intergenic
1032175975 7:129626234-129626256 GTGCAACTACTGTATGTCGAAGG - Intronic
1035736839 8:1894582-1894604 CTGGGACACCTGGATGTCCATGG + Intronic
1036098083 8:5746936-5746958 CTGGAACCACAAAATGTCCCAGG + Intergenic
1037903607 8:22702730-22702752 TGGGATCCAGTGTATGTCCAGGG - Intergenic
1039010410 8:33087297-33087319 CTTAACCCACTGTATGCCCATGG - Intergenic
1039243463 8:35582179-35582201 CTGGAAGCACTGTATAGTCAGGG - Intronic
1042039007 8:64572341-64572363 ATGGAGACACTGTATGTCAAAGG - Intergenic
1043573077 8:81627344-81627366 CTGTAACCAATGCATGCCCAAGG + Intergenic
1045800772 8:106097775-106097797 CTGGACCCAGTGCATTTCCAGGG + Intergenic
1047665758 8:127089362-127089384 GTGGAACCAATGTATTTACAAGG + Intergenic
1048340219 8:133533099-133533121 CTGGAATCCCTGGATTTCCATGG + Intronic
1049215676 8:141406864-141406886 CTGTGCCCACTGTATGTGCAAGG + Intronic
1052456202 9:28701368-28701390 CTGCAACAACTGGATATCCATGG - Intergenic
1052909850 9:33870603-33870625 CTTGAACCACTTTATTTCCTGGG - Intronic
1058494445 9:105540626-105540648 CTGGAATAACTGGATATCCATGG - Intronic
1061265592 9:129503061-129503083 CTGGCCCCACTGTCTTTCCAGGG - Intergenic
1061650612 9:132046017-132046039 CTGGGAGCTCTGTATTTCCAGGG - Intronic
1062535380 9:137018902-137018924 CTGGATCCAGTTCATGTCCAAGG - Exonic
1186904407 X:14095983-14096005 CAGGCACCACTGCATGTCCCTGG + Intergenic
1197163220 X:123346781-123346803 CTGTGACCTCTGTATCTCCATGG + Intronic
1197580021 X:128270497-128270519 CTGGAAGCACTATTTATCCATGG + Intergenic
1198444955 X:136703989-136704011 TTGGATCCACAGTATCTCCAAGG + Intronic