ID: 1110436159

View in Genome Browser
Species Human (GRCh38)
Location 13:75480963-75480985
Sequence GCTCCTCCACGCGTGCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 108}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110436147_1110436159 8 Left 1110436147 13:75480932-75480954 CCCCAGACACCGCCGTCCTCCCG 0: 1
1: 0
2: 0
3: 8
4: 198
Right 1110436159 13:75480963-75480985 GCTCCTCCACGCGTGCTCCTTGG 0: 1
1: 0
2: 2
3: 8
4: 108
1110436156_1110436159 -8 Left 1110436156 13:75480948-75480970 CCTCCCGGGACGGGCGCTCCTCC 0: 1
1: 0
2: 0
3: 13
4: 143
Right 1110436159 13:75480963-75480985 GCTCCTCCACGCGTGCTCCTTGG 0: 1
1: 0
2: 2
3: 8
4: 108
1110436145_1110436159 23 Left 1110436145 13:75480917-75480939 CCATCTCCGGTCACACCCCAGAC 0: 1
1: 0
2: 2
3: 11
4: 150
Right 1110436159 13:75480963-75480985 GCTCCTCCACGCGTGCTCCTTGG 0: 1
1: 0
2: 2
3: 8
4: 108
1110436154_1110436159 -1 Left 1110436154 13:75480941-75480963 CCGCCGTCCTCCCGGGACGGGCG 0: 1
1: 0
2: 1
3: 6
4: 285
Right 1110436159 13:75480963-75480985 GCTCCTCCACGCGTGCTCCTTGG 0: 1
1: 0
2: 2
3: 8
4: 108
1110436155_1110436159 -4 Left 1110436155 13:75480944-75480966 CCGTCCTCCCGGGACGGGCGCTC 0: 1
1: 0
2: 2
3: 6
4: 88
Right 1110436159 13:75480963-75480985 GCTCCTCCACGCGTGCTCCTTGG 0: 1
1: 0
2: 2
3: 8
4: 108
1110436150_1110436159 6 Left 1110436150 13:75480934-75480956 CCAGACACCGCCGTCCTCCCGGG 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1110436159 13:75480963-75480985 GCTCCTCCACGCGTGCTCCTTGG 0: 1
1: 0
2: 2
3: 8
4: 108
1110436146_1110436159 17 Left 1110436146 13:75480923-75480945 CCGGTCACACCCCAGACACCGCC 0: 1
1: 0
2: 1
3: 16
4: 218
Right 1110436159 13:75480963-75480985 GCTCCTCCACGCGTGCTCCTTGG 0: 1
1: 0
2: 2
3: 8
4: 108
1110436148_1110436159 7 Left 1110436148 13:75480933-75480955 CCCAGACACCGCCGTCCTCCCGG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1110436159 13:75480963-75480985 GCTCCTCCACGCGTGCTCCTTGG 0: 1
1: 0
2: 2
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110436159 Original CRISPR GCTCCTCCACGCGTGCTCCT TGG Intronic