ID: 1110438241

View in Genome Browser
Species Human (GRCh38)
Location 13:75498736-75498758
Sequence CACTACAGCGTGAAACTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110438241_1110438247 11 Left 1110438241 13:75498736-75498758 CCCTGGAGTTTCACGCTGTAGTG No data
Right 1110438247 13:75498770-75498792 CACCTGTGAATAGATACTATGGG No data
1110438241_1110438246 10 Left 1110438241 13:75498736-75498758 CCCTGGAGTTTCACGCTGTAGTG No data
Right 1110438246 13:75498769-75498791 GCACCTGTGAATAGATACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110438241 Original CRISPR CACTACAGCGTGAAACTCCA GGG (reversed) Intergenic
No off target data available for this crispr