ID: 1110439967

View in Genome Browser
Species Human (GRCh38)
Location 13:75516880-75516902
Sequence CCATAGTGGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110439967_1110439977 26 Left 1110439967 13:75516880-75516902 CCTTCCACCTTCTGCCACTATGG No data
Right 1110439977 13:75516929-75516951 AAATACAGGCCCCTCAACCTTGG No data
1110439967_1110439973 12 Left 1110439967 13:75516880-75516902 CCTTCCACCTTCTGCCACTATGG No data
Right 1110439973 13:75516915-75516937 AGAAGACCCTCACCAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110439967 Original CRISPR CCATAGTGGCAGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr