ID: 1110443040

View in Genome Browser
Species Human (GRCh38)
Location 13:75546525-75546547
Sequence GCTTCTATTCAAAGACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110443040 Original CRISPR GCTTCTATTCAAAGACAAGC AGG (reversed) Intronic
902845990 1:19111029-19111051 GCTTCTGTTCATAGGCAAGGCGG - Intronic
903363551 1:22792338-22792360 GCTTCTCTTCAAGGACAGGGTGG + Intronic
905228898 1:36499610-36499632 GCTTCTCTTCAAAGCCAGACTGG - Intergenic
906977998 1:50596085-50596107 CCTTCTGTTCAAAGAAAAGCTGG + Intronic
907539631 1:55201704-55201726 GTTTCTATTCAAACTCAAGAAGG + Intronic
910227469 1:84950730-84950752 GCTTGTGTTCAGAGACAGGCAGG - Intronic
910854501 1:91682201-91682223 GGTTCCATTCACAGACAACCAGG + Exonic
914234651 1:145797813-145797835 GCTACTATTAAAAAACAAACAGG - Intronic
916210913 1:162359214-162359236 GCTTGTATTGAGAGTCAAGCAGG - Intronic
917986891 1:180329690-180329712 GCTTGTATTCAAATAGAATCTGG + Intronic
1078350077 11:10585901-10585923 GCTTCTATTGAAAGAAAAGCGGG - Intronic
1078350083 11:10585936-10585958 GCTTCTATTGAAAGAAAGGTGGG - Intronic
1078350091 11:10585971-10585993 GCTTCTATTGAAAGAAAGGTGGG - Intronic
1081000327 11:37661809-37661831 ATTTCTACTCAAAGACAATCTGG - Intergenic
1081407142 11:42710845-42710867 GAATCTATTCAAAGAGAAGTGGG - Intergenic
1081753205 11:45526854-45526876 GCTGGTATTCAAAGCCAGGCTGG - Intergenic
1082830639 11:57614479-57614501 GCTGCACTTCAAAGACCAGCAGG - Exonic
1090242208 11:125192147-125192169 GCTTCTATTCCAATTCCAGCAGG + Intronic
1090492255 11:127175177-127175199 GCTTTTAATGAAGGACAAGCAGG + Intergenic
1091608704 12:1983174-1983196 GATTCTTTTCAAAGATAATCAGG + Intronic
1091706268 12:2695458-2695480 GCTGCTGTGCAAAGACAGGCGGG + Intronic
1093311945 12:17599865-17599887 GCTTCTCTTCATAGACAAAGAGG - Intergenic
1100076064 12:90785373-90785395 ACTTCTATTCAAGGTCAAGCTGG + Intergenic
1100233273 12:92631956-92631978 GCTCCTATTCTATGACAACCAGG - Intergenic
1102489506 12:113281359-113281381 GATTGTCTTCAAAGACAACCTGG - Intronic
1102621554 12:114199816-114199838 GCTTCTTTTCCATGACAAGTAGG - Intergenic
1104831957 12:131758435-131758457 GCATCTTTTCAAAGAGAGGCTGG - Intronic
1107219319 13:37962512-37962534 TCTTCTATTCAGAGACAAACCGG + Intergenic
1108376164 13:49816027-49816049 GCTTCTTTTCATAGACAAAAAGG - Intergenic
1110443040 13:75546525-75546547 GCTTCTATTCAAAGACAAGCAGG - Intronic
1113343097 13:109446345-109446367 CCTTGTGTTCAAAGACAAACAGG - Intergenic
1116759432 14:48992855-48992877 GCTTCTAAGAAAATACAAGCTGG + Intergenic
1118930614 14:70236815-70236837 TCTTCTGTTCAAGGACTAGCAGG - Intergenic
1118954251 14:70465439-70465461 TCTTCTGTTCAAGGACAAGCAGG + Intergenic
1121257409 14:92540765-92540787 GCTTCTCTTCCAAGCCAGGCTGG - Intronic
1121870299 14:97401021-97401043 GCTGCTCTTCAAAGTCAAGGAGG + Intergenic
1126178836 15:45765276-45765298 CCTTATATTCAAAGGCAAGTAGG - Intergenic
1126593623 15:50364409-50364431 GACTCTATTTTAAGACAAGCAGG + Intergenic
1128784321 15:70383661-70383683 CCTTCTGCTCCAAGACAAGCAGG + Intergenic
1133034635 16:3028009-3028031 GCTTCTTTTGGAAGACAATCTGG + Exonic
1134866103 16:17608580-17608602 GACTATATTCAAAGACAAGAAGG + Intergenic
1136141344 16:28290939-28290961 GATGATATTCAAAGAGAAGCAGG - Intergenic
1137891107 16:52162795-52162817 GCTGTTATTCAGAGAGAAGCAGG - Intergenic
1150368366 17:64612084-64612106 GCTTCTGTGAAAATACAAGCGGG - Intronic
1153656442 18:7287014-7287036 TATTCTCTTCAAAGACAAGCTGG + Intergenic
1154351164 18:13584481-13584503 GCTCCTGTTCTCAGACAAGCTGG - Intronic
1156240615 18:35250433-35250455 GCTTCTATACCAAGAGAAACAGG - Intronic
1158618433 18:59008997-59009019 ACTTTTCTTAAAAGACAAGCAGG + Intergenic
1160271628 18:77391208-77391230 GTTTTTATTCAAAGACAAAAAGG - Intergenic
1162449840 19:10748119-10748141 GCTTTTATTCCAAGTGAAGCGGG + Intronic
1163230665 19:15999583-15999605 GCTTCTGTTTATAGCCAAGCTGG + Intergenic
1163473752 19:17512804-17512826 GATTCTATGCAAAGAGAAGACGG - Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
926002497 2:9345099-9345121 GCTTCTAAATAAAGACAACCTGG - Intronic
926328308 2:11804336-11804358 GCTTCTGTTCTATGAGAAGCAGG - Intronic
926770907 2:16374342-16374364 GCATCTGTTCAAAGCCAACCAGG + Intergenic
936059691 2:109286372-109286394 GTTGCAATTCAAAGGCAAGCAGG + Intronic
937414456 2:121703281-121703303 GCTTTTATTCAAACACAATTGGG + Intergenic
938985162 2:136568117-136568139 GTTTCTATTTAATGAGAAGCTGG + Intergenic
939340324 2:140886820-140886842 GCTTCCATTAAGAGACAAGATGG + Intronic
1168963359 20:1883649-1883671 GATTCTATACAAAGAGAAGGGGG + Intergenic
1171184639 20:23116658-23116680 ACTTCTATCCAAAGACAGGCTGG - Intergenic
1172631787 20:36383489-36383511 GCTTCATTTCAGACACAAGCAGG - Intronic
1178557212 21:33602836-33602858 CCTTTTCTTCAAAGAAAAGCAGG + Intronic
1181710959 22:24688290-24688312 GCTTCCCTACATAGACAAGCGGG + Intergenic
950490798 3:13303782-13303804 GTTTATCTGCAAAGACAAGCGGG - Intergenic
951590496 3:24259201-24259223 GTTCCTACACAAAGACAAGCTGG + Intronic
954210215 3:49093079-49093101 GTTTCTAATGAAAGATAAGCAGG + Intronic
954816404 3:53284880-53284902 ACTTGAATTCAAAGTCAAGCAGG + Exonic
954977051 3:54706111-54706133 GCTTCTAGTCAAAGGAATGCTGG - Intronic
956330058 3:68096633-68096655 GCTTGTATTCACAGCCAAGCTGG + Intronic
960105886 3:113796588-113796610 GCTTCTTTTAATAGCCAAGCTGG - Intronic
960460010 3:117922066-117922088 GCTTCATTTCATAGACAAGAAGG - Intergenic
961008236 3:123419288-123419310 GCTGCCATTCAAAGAGAAGTGGG - Intronic
961479376 3:127170097-127170119 TCTTCAATTCCAAGACAGGCAGG + Intergenic
961529995 3:127534710-127534732 GCCTCCCTTCAAAGAGAAGCTGG + Intergenic
961600758 3:128059793-128059815 TGTTCTATTCAAAGAAAATCAGG - Intronic
962157626 3:132965262-132965284 GTTTCTCCTCAAAGACAAGGAGG + Intergenic
963567182 3:146944636-146944658 GCTCCAATTAAAAGACAAACTGG - Intergenic
965537341 3:169836940-169836962 GCTTCTATTCAGAGAGAAATGGG + Intronic
965810176 3:172583690-172583712 GATTTTATTTAAAAACAAGCTGG - Intergenic
966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG + Intronic
967665929 3:192172040-192172062 GGAACTATTCAAAAACAAGCTGG - Intronic
967851387 3:194085234-194085256 TCTTCTTTTCAAAGAAAGGCAGG - Intergenic
968632554 4:1659534-1659556 ACCTCTATGCAAAGACACGCCGG + Intronic
969401124 4:6956354-6956376 TCTTCTATTCCAAGAGAAGCTGG + Intronic
970921912 4:21404293-21404315 GCTTGTATTCTAAAAGAAGCAGG - Intronic
971125565 4:23750271-23750293 GCTTCTATTTCAAGAAAATCAGG - Intergenic
972527057 4:39924450-39924472 GCTTCTATCCTATGCCAAGCTGG + Intronic
973624753 4:52760129-52760151 TCTTCACTTCAAAGACAACCAGG - Intergenic
976504029 4:85825609-85825631 TCTTCAATTGAAAAACAAGCAGG + Intronic
977216549 4:94291865-94291887 GCTTCTATACAAAGAGAGGGTGG - Intergenic
978626501 4:110691624-110691646 GCTCCAATTCAAAGACAGACTGG - Intergenic
981300098 4:143177727-143177749 GCTACTATGCAAAGAGAAGAAGG - Intergenic
981630582 4:146814411-146814433 GCTTCTATTTAAAAAAAAGTTGG + Intronic
994477206 5:100286642-100286664 GCTCCAATTAAAAGACAAACTGG + Intergenic
996646927 5:125828093-125828115 GCTTATCTTCAAAGACACACAGG + Intergenic
1000436583 5:161218013-161218035 CCTTCTATTCACAGAAAAGAGGG + Intergenic
1001711192 5:173779649-173779671 ACTTCCATTCAAAGTCAAGGTGG - Intergenic
1003819132 6:9876522-9876544 GCTTCTATGTAAAGTCTAGCTGG - Intronic
1004589124 6:17031717-17031739 GCTTCTACTTGAGGACAAGCAGG + Intergenic
1005024739 6:21451762-21451784 AGTTATATACAAAGACAAGCTGG - Intergenic
1005139521 6:22612023-22612045 GTTTGTCCTCAAAGACAAGCAGG + Intergenic
1007141928 6:39584565-39584587 GTTTCACTTCAAAGACATGCAGG - Intronic
1007400112 6:41598613-41598635 GGCTCTCTTCAAAGAAAAGCTGG - Intronic
1007871676 6:45046768-45046790 GCCTCTATTAAAAGGCCAGCAGG - Intronic
1009811459 6:68672898-68672920 GCTCCAGTTCAAAGACAATCTGG - Intronic
1014389937 6:120849270-120849292 GCATCTATTAACAGCCAAGCAGG + Intergenic
1015340975 6:132100137-132100159 GCATCTATTTAAAGGCAAGAAGG - Intergenic
1015562821 6:134534834-134534856 GCTTCTACACAAAGAGAATCAGG + Intergenic
1016494258 6:144641979-144642001 AGTTCTAGTCAAAGACAAACAGG - Intronic
1019052453 6:169193471-169193493 GCTTCTATGCAAAGAGAAGCAGG + Intergenic
1022212518 7:28225433-28225455 GCTGCTAAATAAAGACAAGCAGG - Intergenic
1022787356 7:33651931-33651953 GCCACTATCTAAAGACAAGCAGG - Intergenic
1023898329 7:44453591-44453613 GCTGCTATTCAAAGCCATGGAGG - Intronic
1024883555 7:54116159-54116181 GTTTCTATTCAAAGACCATGTGG - Intergenic
1027518779 7:79177031-79177053 GCTTCAGTTCAAAGACTAGCAGG - Intronic
1028991483 7:97053066-97053088 GCTTCAATTAAAAGACAGACTGG + Intergenic
1032455395 7:132069514-132069536 GCTTCTGTTAAAAGAACAGCAGG + Intergenic
1034544283 7:151779660-151779682 GCTCCTAGTCAGAGGCAAGCAGG - Intronic
1035408186 7:158614584-158614606 TCTTCTATTAAAAAATAAGCAGG - Intergenic
1037424714 8:18743285-18743307 GCTTCTTTTCATAGAGGAGCGGG + Intronic
1040934890 8:52772219-52772241 GCTTCTCTTCAAAAAAAAGGAGG - Intergenic
1041477252 8:58280012-58280034 GCTTCCAGCCAAAGACAAGAAGG + Intergenic
1043361363 8:79476156-79476178 GCTTCTATCCAGATCCAAGCTGG - Intergenic
1047301394 8:123616493-123616515 GGTGATATTCAAAGTCAAGCGGG + Intergenic
1050626296 9:7507438-7507460 AATTCTAGTCAAAGACAAGGGGG - Intergenic
1052590186 9:30481974-30481996 GCAGATATACAAAGACAAGCTGG + Intergenic
1056289663 9:85129954-85129976 GCTTATAATGAAAGATAAGCAGG + Intergenic
1061640151 9:131947341-131947363 GCTTCTACTAAAACACATGCAGG - Intronic
1186032857 X:5389277-5389299 GGGTCTATTCAAAGACAAAATGG - Intergenic
1186413256 X:9361971-9361993 GTATTTATTCAAAGAGAAGCAGG + Intergenic
1188401456 X:29750171-29750193 GTTTCTATTTTAAGAAAAGCTGG + Intronic
1193151850 X:78133674-78133696 GCCTGTATTCAAACTCAAGCAGG - Intronic
1193871999 X:86809855-86809877 GCTTCTATCAAAAGACAAATAGG - Intronic
1194887565 X:99335804-99335826 GCTTCTTTTCATACACATGCTGG + Intergenic
1195129877 X:101841226-101841248 GCAGCAATTCTAAGACAAGCGGG - Intronic
1195176359 X:102318597-102318619 GCAGCAATTCTAAGACAAGCGGG + Intronic
1195182505 X:102368496-102368518 GCAGCAATTCTAAGACAAGCGGG - Intronic
1198374987 X:136029930-136029952 GCTTGGATTCTAAGGCAAGCAGG - Intronic