ID: 1110443211

View in Genome Browser
Species Human (GRCh38)
Location 13:75548493-75548515
Sequence TCTTCCCCAGGTCAAATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110443208_1110443211 17 Left 1110443208 13:75548453-75548475 CCTGAATTTCCTCTATTAGGTGC 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1110443211 13:75548493-75548515 TCTTCCCCAGGTCAAATTTATGG 0: 1
1: 0
2: 1
3: 14
4: 163
1110443209_1110443211 8 Left 1110443209 13:75548462-75548484 CCTCTATTAGGTGCAGAATAGTA 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1110443211 13:75548493-75548515 TCTTCCCCAGGTCAAATTTATGG 0: 1
1: 0
2: 1
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110443211 Original CRISPR TCTTCCCCAGGTCAAATTTA TGG Intronic
900816460 1:4850733-4850755 TCATCCCCAGTTCAAATCTGTGG - Intergenic
901111117 1:6796805-6796827 TCTTCTGCAGGCCAAATTTCAGG + Intronic
903640757 1:24858367-24858389 TCTTTCCCAGGTTAAAGATAAGG - Intergenic
905624137 1:39475850-39475872 TCATCACCAGGTCAAGTCTAAGG + Intronic
905671216 1:39791476-39791498 TCATCACCAGGTCAAGTCTAAGG - Intergenic
906037706 1:42762685-42762707 TCTTTCCCAAGTCAGATTTAGGG + Intronic
906815657 1:48875607-48875629 TCATCCCCAGGGCAACTTAAAGG + Intronic
907306991 1:53518954-53518976 TCTTCCCAAGGTAAAACTGACGG + Intronic
908020685 1:59895139-59895161 TCTTCCCGAGGTCCCATTCAGGG + Intronic
909093948 1:71263694-71263716 TCTTCCCCATGTAAAATCTTAGG - Intergenic
910469465 1:87536474-87536496 TCTTCCCAACTTCTAATTTATGG - Intergenic
913372394 1:118115339-118115361 ACTTCTCCAGATTAAATTTAAGG - Exonic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914999012 1:152571162-152571184 GCTTCCCCATGTGAAATGTAAGG - Intronic
916687467 1:167160347-167160369 TCTTACCCATTTCACATTTAGGG - Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921374974 1:214464378-214464400 TCTTCCCCAGCTGAAATAAAAGG + Intronic
921602292 1:217119200-217119222 TCTTGCACAAGTCAATTTTAAGG + Intronic
922985746 1:229864928-229864950 TCTTCCCCAGCTCAATTTGAAGG + Intergenic
1063261906 10:4398695-4398717 TCTACCCCAGTTAAAATTCATGG + Intergenic
1065762361 10:28994216-28994238 TCCTCCCCAGGACACACTTAGGG - Intergenic
1068354655 10:55896294-55896316 TATTCGCAAGGTCAACTTTATGG + Intergenic
1074305941 10:112278653-112278675 TCCTCCTCAGATCAAGTTTAGGG - Intergenic
1077639355 11:3867437-3867459 TTTACCTCAGGTCAAATTTGAGG + Intronic
1078426201 11:11253348-11253370 TCTTCCCCCAGTCAAATGAACGG + Intergenic
1079111356 11:17606888-17606910 TCTGTCCCATGTCAAGTTTAAGG - Intronic
1084760428 11:71267395-71267417 CCTTCCCCAGGTCACAGTTAAGG + Intergenic
1087275521 11:96156687-96156709 ACTTCCTCTGGTCAAACTTAAGG - Intronic
1088158991 11:106845171-106845193 TCTACTCCAGGCCAAATATATGG + Intronic
1091119638 11:133046095-133046117 ACTTCCCCAGGTCGAATCTCGGG - Intronic
1091948183 12:4568057-4568079 TCTTCCCCAGTGAAAATTCAAGG - Intronic
1093540714 12:20281075-20281097 TCTTCCCAAGGGGAGATTTATGG - Intergenic
1094182474 12:27606667-27606689 TCTTCCCCAGCCCAAACTTACGG - Intronic
1097560356 12:61197528-61197550 TCTTCCCCAATTCTGATTTAAGG + Intergenic
1097807882 12:63985674-63985696 TCTGCCCCAAGTGAAATTAAAGG - Intronic
1097844069 12:64348660-64348682 TCTTCCTCAGGTTATATTTTAGG + Intronic
1100167371 12:91931301-91931323 TCTTCCCCAGGGTAAATTCAAGG + Intergenic
1101054652 12:100899657-100899679 TTTTCCCCTGGGAAAATTTAAGG + Intronic
1102886252 12:116524371-116524393 TTTTTCCCGGGTTAAATTTATGG + Intergenic
1105669914 13:22601748-22601770 ACTTACCCAGGTCACATTGAGGG + Intergenic
1109179887 13:59201030-59201052 TCCTGCCCATGTCAAATTGAGGG + Intergenic
1110443211 13:75548493-75548515 TCTTCCCCAGGTCAAATTTATGG + Intronic
1110707615 13:78612762-78612784 TCTGCCACAGGTTAAATTTAGGG - Intergenic
1116199494 14:41772681-41772703 TTTTCCACAAGTTAAATTTAAGG - Intronic
1116537911 14:46059373-46059395 TCTTCCCCTTGTCAAACATATGG - Intergenic
1117230904 14:53717787-53717809 TCTTCACCTGGTTAAAGTTATGG + Intergenic
1118697848 14:68402348-68402370 CCTTCCCCAGTTCAAATGGATGG + Intronic
1120455666 14:84727146-84727168 TCATCCCCATGTGAATTTTAAGG + Intergenic
1120681124 14:87481607-87481629 TCTTCCCCAGGACAACTCTCTGG - Intergenic
1122001097 14:98654137-98654159 ACTTCCACAGGTCAATTTTTGGG - Intergenic
1124209992 15:27754767-27754789 TCTTCTGCAAGTCAAATTTCTGG + Intergenic
1126052207 15:44696246-44696268 TCTTCCCCAGGGAAAATTCTGGG + Intronic
1127566643 15:60195794-60195816 ACATCCCCAGGTCAAATTCTTGG - Intergenic
1131734223 15:95314836-95314858 TATTCCCCATGCCAAAATTAAGG - Intergenic
1135910537 16:26556671-26556693 TCTTCCCCAGGTGAGATTAGAGG + Intergenic
1138177683 16:54916183-54916205 TTTTACCCAGGTCAGTTTTAAGG + Intergenic
1139691323 16:68643845-68643867 CCGTCCCCAGCTCAGATTTAGGG - Intronic
1147266081 17:39235811-39235833 TCTTCCCCAGGAGAGACTTAAGG + Intergenic
1149144760 17:53477017-53477039 TTTTCCCAAGGTAAAATTTGGGG + Intergenic
1149271311 17:54981027-54981049 GCTTCCCCAGGTCACATTGGAGG - Intronic
1153050143 18:894206-894228 TCTTCCCCATGTCAGGTTTCAGG - Intergenic
1154402285 18:14051479-14051501 ACTTCCCCAGCTCAAATTGATGG - Intergenic
1155031901 18:21991985-21992007 TTTTCCCTAGGTCAAATGGAAGG - Intergenic
1155969598 18:32069797-32069819 TCTTCACCAGGTAAATTTTAAGG - Exonic
1156868380 18:41914597-41914619 TCTTCCCCAGGCAAAGTTAAAGG + Intergenic
1157422246 18:47556925-47556947 TCATTTCCAGGTCATATTTAAGG - Intergenic
1157971855 18:52279517-52279539 TCCTCACCATGTCAAATGTAAGG - Intergenic
1159668223 18:71190282-71190304 TCTTCCCCACTGAAAATTTAAGG + Intergenic
1160257755 18:77261735-77261757 TCTTCCCCACCTCAATTTAAAGG - Intronic
1161384614 19:3984338-3984360 TCTTGCCCAGGTGAACTTCACGG - Exonic
1164804450 19:31105662-31105684 TCTTCCCCAAGACAAAGTTTGGG + Intergenic
1167548569 19:50143988-50144010 TCTTCCCCAGGATAACTTTGTGG - Intergenic
925580173 2:5401904-5401926 TCTTCCCCAGGTACAAGTGATGG - Intergenic
926142097 2:10373844-10373866 TCTTACCAAGGTCAAATCTTTGG + Intronic
930281663 2:49376866-49376888 TCTTCCTCAGCTCACATTTATGG + Intergenic
930749848 2:54923844-54923866 TCTTAAACAGGTAAAATTTATGG - Intronic
930763711 2:55062537-55062559 TCTTTCCCATTTCAAAATTAAGG + Intronic
931076606 2:58721680-58721702 TCTTCCCCAAGTCCTATTAATGG - Intergenic
934868521 2:97837579-97837601 TCTTCCCCATCTCACAATTATGG - Intronic
935669684 2:105544422-105544444 TCTTCCCCATTTCAAAGTCATGG - Intergenic
936548950 2:113418209-113418231 TTTTCTCCAAGACAAATTTAGGG - Intergenic
938911536 2:135889785-135889807 TCTTCCTCAGCTCAAACTTATGG - Intergenic
939193881 2:138948488-138948510 TCTCCTCCAGGTCAAGTATAAGG - Intergenic
940446102 2:153779021-153779043 GCTTCCTCAGCTGAAATTTAGGG + Intergenic
942215672 2:173716955-173716977 TCTTCTCCAGGGCAAATACAAGG - Intergenic
942559531 2:177205921-177205943 TCTTCAAAAGGTCAATTTTATGG + Intergenic
943204555 2:184876721-184876743 CCTTCCCCAAGTCAACCTTATGG + Intronic
945512437 2:210719427-210719449 TCTTAGCCAGGTGAATTTTACGG + Intergenic
947347206 2:229204879-229204901 TATTCTCTAGGTCAGATTTATGG + Intronic
1169274570 20:4224816-4224838 TATTCCCCAGGTCAAAGAGAGGG - Intronic
1169630813 20:7628996-7629018 ACTACCACAGGTCAAATTTGTGG + Intergenic
1174560601 20:51428213-51428235 TGTTCCCCAGGTACAATTTGGGG + Intronic
1175191966 20:57217317-57217339 TCTTCCCCAGGGCCTAGTTAGGG - Intronic
1177052477 21:16254263-16254285 TATTCTCCAAGTAAAATTTAAGG - Intergenic
1178295538 21:31406972-31406994 TCTTTCCCAGGACACTTTTAAGG + Intronic
1183405514 22:37628781-37628803 TCTTCTCTAGGTCAGATTTGGGG + Intronic
952178618 3:30894495-30894517 TAGTCCCCAGGTCAAAAATAAGG + Intronic
953487519 3:43316324-43316346 TCTCCCCCAGGTGAAACTGATGG - Intronic
953970679 3:47344529-47344551 TTTTCCCCATGTCTAATTTTGGG + Exonic
957010582 3:75001121-75001143 TCTTCCCAAGGTCTAGTTTCTGG + Intergenic
957152277 3:76500807-76500829 TCTTCCCTTGTTCAAAATTAAGG - Intronic
957536027 3:81504668-81504690 TCTTCCTTGGTTCAAATTTAAGG - Intronic
958048872 3:88319346-88319368 TCCTCCCCGGGCCAAATCTAGGG - Intergenic
962557107 3:136564942-136564964 TCATACACATGTCAAATTTAAGG - Intronic
964769809 3:160212358-160212380 TCTTCCCCTGGTATAAGTTAGGG - Intergenic
966690247 3:182734231-182734253 TCTTCTCCACTTCAAATTCAGGG - Intergenic
967359062 3:188609443-188609465 CCTTCATCAGGACAAATTTATGG + Exonic
967688456 3:192444893-192444915 CCGTCCTCAGGTAAAATTTAAGG + Intronic
970367732 4:15377237-15377259 TTTTCCCCAACTCAAATTTGTGG + Intronic
972468322 4:39379881-39379903 TCTTCTAGAGGTCCAATTTATGG + Intergenic
975238884 4:72032794-72032816 GCCGCCCTAGGTCAAATTTAGGG + Intronic
976907285 4:90254705-90254727 TCCTACCCAGCTCAACTTTATGG - Intronic
977816496 4:101419251-101419273 TATTACCCAGGTCATTTTTATGG + Intronic
977933356 4:102773110-102773132 TCTTCCCCATTGCAATTTTATGG - Intergenic
979178908 4:117700992-117701014 GCTTCCTCAGGTCACACTTATGG + Intergenic
979378599 4:119980336-119980358 TCTTCCACAGGTCAAATAATAGG - Intergenic
979923788 4:126534067-126534089 TCTTTCCAAAGTCAATTTTAAGG + Intergenic
982302372 4:153892812-153892834 TCTTCCCCAGGGCAAGTCAAGGG + Intergenic
983865891 4:172766276-172766298 TCATTCCCAGGTGAAATTTTTGG + Intronic
986670285 5:10137572-10137594 GCTTCCGCTGGTCAGATTTAGGG - Intergenic
987593587 5:19965698-19965720 TCTCCACCAGGTTACATTTAAGG + Intronic
988468700 5:31515712-31515734 TAGTCCTCAGGCCAAATTTATGG - Intronic
989578590 5:43011180-43011202 TCTCCCCCAGGGCACATTAAAGG - Intergenic
991453348 5:66776521-66776543 TCTTCTCCATATCAAGTTTAAGG + Intronic
992901185 5:81298562-81298584 TCTTCTCCAGATCTATTTTATGG + Intergenic
992907838 5:81364092-81364114 TATTTACCATGTCAAATTTATGG + Intronic
994406363 5:99350859-99350881 TCTTCCCCATCTCTAATATATGG + Intergenic
997191810 5:131944988-131945010 TCTTCCTGAAGTCAAATTTTGGG + Intronic
997266651 5:132498652-132498674 CCTCTGCCAGGTCAAATTTATGG - Intergenic
997942194 5:138168381-138168403 TATTCCCCATGTCACATTTTAGG + Intronic
998894104 5:146779698-146779720 TCATCCCCGGGTTTAATTTATGG + Intronic
998894380 5:146783233-146783255 TCATCCCCAGGTTTAATTTATGG + Intronic
1000634932 5:163633185-163633207 TCTTGCTCAGGTCAAACTCAGGG - Intergenic
1004384395 6:15159869-15159891 TTTTCCCAAGGTCAAAGTTAGGG + Intergenic
1004804470 6:19187728-19187750 TCTTTCCCAGGACACACTTATGG + Intergenic
1004829042 6:19457630-19457652 TCTTCCCCAGGTCAAACCCTGGG + Intergenic
1006818190 6:36867838-36867860 TCTTCCCCACTTCAAATGTTAGG - Intronic
1010397471 6:75408711-75408733 TTTTCCCCAAGTCACTTTTAAGG + Intronic
1014285816 6:119496076-119496098 CCTTCACCTGGTCAAGTTTATGG - Intergenic
1015049257 6:128818995-128819017 TCTTCCCCAGGTCTGGTTTCTGG + Intergenic
1015182666 6:130377781-130377803 TCTTCCCCAGCTGGAATATAAGG - Intronic
1019859933 7:3648837-3648859 TTTTCCCAAGGTCAGAATTACGG - Intronic
1022181814 7:27927872-27927894 TCTTCCCCAAATCAATTTTCAGG + Intronic
1023726851 7:43151221-43151243 TCTTCCCCAGGTGACACTCAGGG + Intronic
1026532187 7:71209269-71209291 TCTTCCTCAGGTCACAGTTTAGG + Intronic
1030702005 7:112650526-112650548 TCCTCACCAAGTCACATTTAAGG - Intergenic
1031823471 7:126533338-126533360 TCTTCCCCTGCTCAAATATTCGG + Exonic
1032300813 7:130684912-130684934 TCTTCTTCAGGGCCAATTTAAGG + Intronic
1037007818 8:13804201-13804223 TTTTCCCCAGGACCAATTTGGGG + Intergenic
1039141427 8:34393138-34393160 TCTATCCCAGATCAAAATTAGGG + Intergenic
1039172624 8:34765649-34765671 TCTTTTCAAGGTCAAGTTTAAGG - Intergenic
1041292215 8:56318830-56318852 CCTTCCCCAGTTGAAGTTTAGGG + Intronic
1041315271 8:56555066-56555088 TCTTTCCCTGTTCAAATTTCTGG - Intergenic
1042402889 8:68370105-68370127 TCTGCCCCAGGGAAAATTTAGGG - Intronic
1047083600 8:121492144-121492166 TCTCCCCCAGGACATAGTTATGG + Intergenic
1047175585 8:122537635-122537657 CCTTTCCAAGGTCAAATTTTAGG - Intergenic
1047447448 8:124932064-124932086 TCTTCCCAAGTTCAAATTCCAGG - Intergenic
1050053712 9:1630158-1630180 TCTTCTCCAGGTCATTTCTATGG + Intergenic
1050943281 9:11486517-11486539 TCTTTTATAGGTCAAATTTAAGG + Intergenic
1053747002 9:41208943-41208965 TTTTCTCCAAGACAAATTTAGGG + Intergenic
1054480285 9:65656417-65656439 TTTTCTCCAAGACAAATTTAGGG - Intergenic
1054681345 9:68222339-68222361 TTTTCTCCAAGACAAATTTAGGG - Intergenic
1056621312 9:88217054-88217076 TCCTCCCTAGGGCAAATTCATGG - Intergenic
1057329586 9:94100942-94100964 TCTTCCCTATGTCAAATTTCAGG + Intronic
1057820661 9:98328090-98328112 ACTTCTCAAGGTCACATTTAAGG + Intronic
1059032533 9:110714414-110714436 TCTTCTCCAGGACAAAATAAGGG - Intronic
1060979336 9:127783732-127783754 TCCTCCCCACCTCCAATTTAGGG + Intergenic
1062383515 9:136299045-136299067 CCTGCCCCAGGTCAAGTTCAGGG - Intronic
1202783131 9_KI270718v1_random:19722-19744 TTTTCTCCAAGACAAATTTAGGG + Intergenic
1186975742 X:14902550-14902572 TCATTTCCAGGTCTAATTTATGG - Intronic
1188418933 X:29972819-29972841 TCTTCCACTGGTCTCATTTAGGG + Intergenic
1188522529 X:31054635-31054657 CCTTCTCCATCTCAAATTTATGG - Intergenic
1189360610 X:40347909-40347931 TCTGCCCCAGCTCACACTTAGGG - Intergenic
1192324417 X:70120271-70120293 TCCTCCCCAGGACAATTTCAAGG - Intergenic
1194645663 X:96455464-96455486 TTTTCCCCAGGACAAATTTAAGG - Intergenic
1194732041 X:97466028-97466050 TCTTCTCTAGCTCAAATTCAGGG - Intronic
1197873737 X:131083487-131083509 TCACCCCCAGGGAAAATTTAAGG + Intronic
1198866347 X:141127530-141127552 TCTTCCCCCAGACAAATTTTAGG - Intergenic
1201016353 Y:9606578-9606600 TCTTCCCCCAGACAAATTTTAGG - Intergenic