ID: 1110454497

View in Genome Browser
Species Human (GRCh38)
Location 13:75675422-75675444
Sequence TTGTAAACAAAGTTTAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110454493_1110454497 27 Left 1110454493 13:75675372-75675394 CCTGTTACAACATATTTCTACCC 0: 1
1: 0
2: 0
3: 10
4: 126
Right 1110454497 13:75675422-75675444 TTGTAAACAAAGTTTAAGCTAGG 0: 1
1: 0
2: 2
3: 29
4: 270
1110454496_1110454497 -3 Left 1110454496 13:75675402-75675424 CCTTTCAGTTATAAAATCTTTTG 0: 1
1: 0
2: 4
3: 46
4: 590
Right 1110454497 13:75675422-75675444 TTGTAAACAAAGTTTAAGCTAGG 0: 1
1: 0
2: 2
3: 29
4: 270
1110454495_1110454497 6 Left 1110454495 13:75675393-75675415 CCTGTATTTCCTTTCAGTTATAA 0: 1
1: 0
2: 3
3: 35
4: 373
Right 1110454497 13:75675422-75675444 TTGTAAACAAAGTTTAAGCTAGG 0: 1
1: 0
2: 2
3: 29
4: 270
1110454494_1110454497 7 Left 1110454494 13:75675392-75675414 CCCTGTATTTCCTTTCAGTTATA 0: 1
1: 0
2: 2
3: 32
4: 427
Right 1110454497 13:75675422-75675444 TTGTAAACAAAGTTTAAGCTAGG 0: 1
1: 0
2: 2
3: 29
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110454497 Original CRISPR TTGTAAACAAAGTTTAAGCT AGG Intronic
901257650 1:7844821-7844843 TAAACAACAAAGTTTAAGCTGGG - Exonic
904249748 1:29214672-29214694 TTTTAAAGCAAGTTTGAGCTGGG + Intronic
904683756 1:32246676-32246698 TTGAAAACAAAGTTTAAAAAAGG + Intergenic
905814415 1:40938082-40938104 CTGTAATGAAATTTTAAGCTGGG - Intergenic
907989059 1:59561369-59561391 TTGAAAACAAAGTATATGCTAGG + Intronic
908875088 1:68664321-68664343 TTATAAACAAATTTTAACATAGG - Intergenic
910631539 1:89360378-89360400 TGTTAAAAAAAGTTTGAGCTTGG + Intergenic
911459267 1:98168948-98168970 TTGTAATCAAAGTGTTAGCCGGG - Intergenic
912548851 1:110471256-110471278 TTGTAAATACAGTTTGTGCTGGG - Intergenic
914426190 1:147579159-147579181 ATGAAAACCAAGTTTCAGCTGGG - Intronic
915459851 1:156063444-156063466 TTGTAAAAAAACATTGAGCTGGG - Intronic
917034207 1:170729201-170729223 TAGTAAAAAAAGTATAAGATTGG + Intronic
919314296 1:195952020-195952042 TTGTAAATAAACTTTATGGTGGG - Intergenic
920287146 1:204888614-204888636 TATTAAACAAAGTTTATGCGAGG - Intronic
922815297 1:228444841-228444863 TTATAGACAAAATTGAAGCTGGG - Intergenic
924927585 1:248697885-248697907 TTTTGAAGAAAGTTTAAGCTTGG - Intergenic
1063003400 10:1945615-1945637 TTATAAACAACCTTTAAGCCAGG + Intergenic
1063336506 10:5220688-5220710 TTGAAAAGAAAGTTTAGGCCAGG + Intergenic
1065421470 10:25549389-25549411 TTGTATTCCAAGTTTGAGCTCGG - Intronic
1066250998 10:33632626-33632648 TGGCAAACAAAATTTCAGCTTGG - Intergenic
1067379812 10:45762489-45762511 TTCTAAAGAAACTTTCAGCTCGG - Intronic
1067611599 10:47722489-47722511 TTGTAATCAAGGTGTAGGCTGGG + Intergenic
1067887510 10:50103143-50103165 TTCTAAAGAAACTTTCAGCTCGG - Intronic
1068263616 10:54618015-54618037 TTGAAAACAAAGTTACAGTTGGG - Intronic
1068324652 10:55468344-55468366 TTTCAATCATAGTTTAAGCTAGG + Intronic
1068615341 10:59108516-59108538 TTGTAAACAAAATTTGACCAGGG - Intergenic
1068730709 10:60355110-60355132 TTGTTAACAATGTTTAATCCCGG + Intronic
1071021074 10:81057509-81057531 TGGTAAACAAAGTCCACGCTTGG - Intergenic
1072155677 10:92721603-92721625 TTTTAAAAAAAGTTTTGGCTGGG - Intergenic
1073690997 10:105809270-105809292 TTGCAAACAAGGCTTAAGTTTGG + Intergenic
1074059384 10:109950948-109950970 TTCAAAACAAAGTTTCAGCAAGG + Intronic
1074073619 10:110099222-110099244 TTTTAAATAGAGTTTAAGCTGGG - Intronic
1078174266 11:8957616-8957638 TTGGAAACAAAGTTACAGCTTGG + Intronic
1078525328 11:12096643-12096665 TTCTTAAGATAGTTTAAGCTAGG - Intronic
1080149854 11:29038772-29038794 TGGAAAAAAAAGTTTAAGATGGG - Intergenic
1080477144 11:32606484-32606506 TTGCAATCAAGCTTTAAGCTGGG + Intronic
1080710079 11:34738222-34738244 TTGTAAACAAAGTTCAGACTGGG + Intergenic
1081093242 11:38899355-38899377 ATGTAAAAACATTTTAAGCTTGG - Intergenic
1081239421 11:40685441-40685463 TTATAAACAAGATTTAAGGTGGG + Intronic
1081659308 11:44878188-44878210 TTGTTAACACAGTCTAATCTGGG - Intronic
1081897435 11:46598725-46598747 TTAAAAAAAAAGTTTAGGCTGGG + Intergenic
1086536205 11:87849787-87849809 TTGCAAACAAAATTTAACCTTGG + Intergenic
1087890234 11:103529772-103529794 TTGTAAGTAAAGTTTTACCTAGG - Intergenic
1088036410 11:105322049-105322071 TTGGAAACCAATTTTAAACTGGG - Intergenic
1088095395 11:106094515-106094537 ATGTAAACAAAGTTACATCTAGG + Intronic
1088631990 11:111782461-111782483 TTGCAAAAAAAATTAAAGCTGGG + Intronic
1089235975 11:117025725-117025747 TTTTAAAGAAAGTATAGGCTGGG - Intronic
1089473627 11:118740782-118740804 GTGTTAGCAAAGTTTAACCTTGG - Intergenic
1093399295 12:18724930-18724952 TTTCAAACAGAGTATAAGCTTGG + Intronic
1094020249 12:25906254-25906276 TTTTAAAAAAAGATTAGGCTGGG - Intergenic
1097774090 12:63625783-63625805 ATGTATACAAAGTTTCAGTTAGG + Intronic
1098520407 12:71429576-71429598 TTGAAAATAAAGTTTCAGCAAGG - Intronic
1098906634 12:76169621-76169643 GTGTAAACAAAGTTCGAACTGGG - Intergenic
1099494830 12:83334397-83334419 TTATAATCAAAGTGTCAGCTGGG - Intergenic
1099531873 12:83792164-83792186 GTGTAACCCAAGTATAAGCTAGG - Intergenic
1100283026 12:93136784-93136806 TTGTAAATAAAGTTTTATTTGGG + Intergenic
1100782378 12:98042774-98042796 TTTTAAATCAAGTTTAAGATTGG + Intergenic
1101010695 12:100446240-100446262 TTGAAAATAAAGTTGAGGCTGGG + Intergenic
1101259777 12:103016986-103017008 TTGAAAATAAAGATTGAGCTGGG - Intergenic
1102264621 12:111472724-111472746 TTTTAAAAAAAGTATTAGCTGGG - Intronic
1102853018 12:116268754-116268776 TTGTAAACAAGTTTTATGGTGGG - Intronic
1103592379 12:122001349-122001371 TTGAAAAAAAAATTTAGGCTGGG - Intronic
1105564226 13:21527824-21527846 TTGTAAACAAGGTTTGAGGGAGG + Intronic
1106763243 13:32888570-32888592 TTGTAAATAAAGTTTGATATTGG + Intergenic
1107221805 13:37990607-37990629 TTGTAAATAATTTTTAAGTTAGG - Intergenic
1107295824 13:38906245-38906267 TTGTAACCAAGGTGTCAGCTGGG - Intergenic
1107761025 13:43678891-43678913 TTGTAAATAAAGTTGATGTTTGG - Intronic
1109521561 13:63518593-63518615 TAGAAAACAAAGTCTGAGCTTGG + Intergenic
1109784964 13:67161503-67161525 TTCTAAACACAGTTTAACCATGG + Intronic
1110091378 13:71452421-71452443 TTGAAAAAAGAATTTAAGCTAGG - Intronic
1110454497 13:75675422-75675444 TTGTAAACAAAGTTTAAGCTAGG + Intronic
1111780861 13:92721957-92721979 TTCTAATCAAAGATTCAGCTAGG - Intronic
1111813251 13:93118855-93118877 TGGAAACCAAAGATTAAGCTTGG + Intergenic
1112558253 13:100489008-100489030 TTGAAAATAAAGTTTTGGCTGGG + Intronic
1112947325 13:104946036-104946058 TTGGGAACAAAATTTAAGATGGG + Intergenic
1113142139 13:107165776-107165798 TTATAAACATTGTTAAAGCTTGG + Exonic
1114142126 14:19924931-19924953 TTTTAAACAAAATTTAAGGTGGG - Intergenic
1114750230 14:25196192-25196214 TTGTATACAAAGTATAAGACAGG - Intergenic
1115006933 14:28497252-28497274 TTGCAAAAAAAGTTTAATATTGG + Intergenic
1115774674 14:36702321-36702343 TTGGAAACAATGTTTGGGCTTGG - Intronic
1116718342 14:48457248-48457270 TTGAAAAGAAACTTTGAGCTGGG + Intergenic
1117928292 14:60808901-60808923 TTGTAAACTAAGGTTAACTTTGG + Intronic
1118119605 14:62824423-62824445 TAGTAAACAAAGTTTTAGCTGGG + Intronic
1119057214 14:71435116-71435138 ATGTATACAATGTTTAAGCAGGG - Intronic
1119314514 14:73681470-73681492 TTATAAACAATGTTTTAGCTGGG + Intronic
1119580070 14:75770491-75770513 TTGTAAACAAAGTTTGTGTTGGG + Intronic
1119983662 14:79111433-79111455 TTGTTAATAAACTTTAAGCAGGG - Intronic
1121548764 14:94782200-94782222 TTTAAAACAAAATTGAAGCTGGG + Intergenic
1121891603 14:97597984-97598006 TTTAAAACAATGTTTAAGCTAGG + Intergenic
1122222008 14:100245428-100245450 TTCAAAACATAGTTGAAGCTGGG - Intronic
1123795270 15:23764700-23764722 TTGTAAATCAAGTTAAAGATAGG - Intergenic
1124812218 15:32952552-32952574 TTGAAAACAAAGTTTAAAGCTGG + Intronic
1126919422 15:53504406-53504428 TTGGAAACAAATTTTATGCTGGG + Intergenic
1127877778 15:63125461-63125483 TTTTTAAAAAATTTTAAGCTGGG - Intronic
1131746029 15:95448136-95448158 TTTTAAACAAAATTTCAGCTTGG - Intergenic
1133251561 16:4485407-4485429 TAGTAAACAAAGACTATGCTTGG - Intronic
1134926988 16:18172839-18172861 TTGTAAATAAAATTAAAGTTGGG + Intergenic
1135712267 16:24728151-24728173 TTGTAAAGCCAGTTGAAGCTGGG + Intergenic
1136012905 16:27375904-27375926 TTAAAAACAAAGTTTAGGCCGGG - Intergenic
1136922140 16:34342111-34342133 TTGTAAACAGAATTGAACCTGGG + Intergenic
1136982433 16:35069695-35069717 TTGTAAACAGAATTGAACCTGGG - Intergenic
1137636050 16:49987331-49987353 CTGTAAACAAAGTATACTCTCGG - Intergenic
1138030329 16:53554847-53554869 TTGTTAACAATGTTTAGGCCAGG + Intergenic
1138098094 16:54229370-54229392 TTGGCCAGAAAGTTTAAGCTTGG + Intergenic
1138780585 16:59780264-59780286 TTGTAAAAAAAATCTAAGCCAGG - Intergenic
1138913354 16:61430518-61430540 TAGAAAACAAAGTTAAAGATGGG - Intergenic
1139026086 16:62819830-62819852 TTATAAATCAAGTTTAAGGTAGG - Intergenic
1140249108 16:73279151-73279173 TTTTGCACAAATTTTAAGCTAGG + Intergenic
1144108103 17:12004388-12004410 TTGTTAAGAAACTTTAAACTAGG - Intergenic
1145819990 17:27824861-27824883 ATGTATACAATGTTTAAGCAGGG + Intronic
1145837494 17:27965568-27965590 TTGAAAGCAAAGTTCAAGCCAGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146716684 17:35091815-35091837 TTGTAAACTAAGTTTATGAAAGG - Intronic
1147351236 17:39846552-39846574 TTATAAATAAAATTTAAACTTGG + Intronic
1149095284 17:52832760-52832782 TTGTCAAAAATGTTTAATCTTGG - Intergenic
1149098407 17:52872531-52872553 TTTTAAGCAAAACTTAAGCTTGG - Intronic
1149211212 17:54303552-54303574 GTATAAACAAATTTTCAGCTGGG - Intergenic
1149703608 17:58675695-58675717 TTGTAAACAAAGCTTATTCTGGG - Intronic
1151102247 17:71569376-71569398 TTGTATACAAAATTGAAGTTTGG + Intergenic
1152101941 17:78306839-78306861 TTGCAAACAAGGTGTCAGCTGGG + Intergenic
1153847668 18:9064358-9064380 TTGTAAAAAAAGTTATAGCCTGG + Intergenic
1156132337 18:33991308-33991330 TTATAAATAAAGTTTCAGTTGGG - Intronic
1157606836 18:48931187-48931209 ATGGGAACAAAGTTTCAGCTAGG + Intronic
1157753895 18:50201120-50201142 TTGCAATCAAAGTGTCAGCTGGG - Intergenic
1158357015 18:56632596-56632618 GTGTTAACACAGTTTAATCTTGG - Intronic
1158375967 18:56867330-56867352 TTTTAAAAAAATTTTATGCTGGG - Intronic
1158590908 18:58778118-58778140 TTTTAAAAAAAGCTTCAGCTGGG + Intergenic
1158767011 18:60463470-60463492 TTTTAAAAAAAGTTTTAGTTTGG + Intergenic
1159790557 18:72774271-72774293 TTCTAAACAAAGAATAAGATTGG + Intronic
1160177523 18:76607965-76607987 TTTTAAAAAAAATTTAAGTTGGG + Intergenic
1160600179 18:80006516-80006538 TTGTAAACTGAGTTTCAGCATGG + Intronic
1162462713 19:10822792-10822814 TTATAAAAAAAGTTTTGGCTGGG - Intronic
1162599904 19:11660811-11660833 CTGGAAAAAAATTTTAAGCTGGG + Intergenic
1164071597 19:21774072-21774094 TTGTAAAGAAATTTTAGGCCGGG - Intergenic
1166018578 19:40003330-40003352 TTTAAATCAAATTTTAAGCTGGG - Intronic
1166064148 19:40346993-40347015 TTTTATACAAAGTGTGAGCTGGG + Intronic
1168046064 19:53795202-53795224 ATGCAATCAAAGTTTAGGCTGGG - Intronic
1168444728 19:56402259-56402281 TTATAAACAATGTTTCAGCTGGG + Intronic
925356152 2:3242795-3242817 TTGTAAACGATTTGTAAGCTGGG - Intronic
926355375 2:12036597-12036619 TTGTTAAAAAATTTTGAGCTGGG - Intergenic
927768839 2:25840024-25840046 TTTTAAAGATAGTTTAAGCTGGG - Intronic
929832951 2:45363635-45363657 TTGTGAACAAAGTATAATCATGG - Intergenic
930917589 2:56712711-56712733 TTTTAAAGAAATTTTAAGCCAGG + Intergenic
931873603 2:66487811-66487833 TTGTAAGCAAACTTTCAACTTGG - Intronic
937079488 2:119130175-119130197 TATTAAACAAACTTAAAGCTTGG + Intergenic
937430531 2:121833989-121834011 ATTTAAAAAAAGTTTAAGCCGGG - Intergenic
937560169 2:123213859-123213881 TTTAAAAAAAAGTTTTAGCTAGG + Intergenic
939333406 2:140792369-140792391 TTGTCAACAAAATCTAAGATGGG - Intronic
939696743 2:145335154-145335176 TTATACACCTAGTTTAAGCTCGG - Intergenic
939910374 2:147975464-147975486 TTTTAAAGAAAGTTCAAGCCAGG + Intronic
941122542 2:161547387-161547409 TTGTAAATAAAGTTTAAAGATGG - Intronic
941877334 2:170447534-170447556 TTGTCAACTAAGTTTACTCTTGG - Intronic
942587213 2:177494520-177494542 TTGTAAACAATGTTAGACCTAGG + Intronic
943246576 2:185460680-185460702 TTGTAAACTTTGTTTAAGTTAGG + Intergenic
945089726 2:206167559-206167581 TTAAAAACAAAGTTTAGGCTGGG - Intergenic
945737181 2:213615295-213615317 TTTAAAACAAACTTTAGGCTGGG + Intronic
946251057 2:218412744-218412766 TTGAAAAAAGAGTTTAGGCTGGG + Intergenic
946592854 2:221270495-221270517 TTTTAAAAAAAGTTTGAGGTTGG - Intergenic
946844008 2:223843307-223843329 TTAAAAACAAAATTTCAGCTGGG - Intergenic
1170027258 20:11903112-11903134 TTGGAAATAAAGTTTAGGTTAGG - Intronic
1170048290 20:12111380-12111402 TTGTAAATAAAATTGAAGCAAGG + Intergenic
1170314372 20:15027577-15027599 TTGTGAAAAAAGTTTAGCCTTGG + Intronic
1171565340 20:26179429-26179451 AAGTAAACAAAGTTTAAATTTGG - Intergenic
1174290405 20:49504398-49504420 TTAAAAACAAAGTTTAGGCCGGG + Exonic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174910871 20:54606263-54606285 TTAAAAAAAAAGTTTAAGTTAGG - Intronic
1174952722 20:55060570-55060592 TTGTTGAGAAAGTTTAAGCAGGG + Intergenic
1175198055 20:57259401-57259423 TTGGAAACACAGTTTATACTTGG + Intronic
1176225570 20:63996608-63996630 ATGTAAACAAATTTCAGGCTGGG - Intronic
1177370138 21:20192227-20192249 TTGTAAACAAAAAGTAAGATAGG + Intergenic
1177557735 21:22714242-22714264 TTGTAAACACATTTTATGCATGG + Intergenic
1178051256 21:28750401-28750423 TAGAAAACAAAGTCTCAGCTGGG + Intergenic
1178104362 21:29301022-29301044 TTGCAAACAAAGTTTAGGAATGG + Intronic
1179662595 21:42886693-42886715 ATGTAAACAAATGTAAAGCTCGG - Intronic
1184180042 22:42815031-42815053 AGGTAAAGAAAGTTTAGGCTGGG - Intronic
950908996 3:16568007-16568029 TTGTAAACAAAGTTTTAGAGTGG + Intergenic
951316763 3:21196721-21196743 ATGTATAGAAAGTGTAAGCTGGG + Intergenic
952914777 3:38227103-38227125 TTCTAAACAAAGTTTAATTTTGG - Intronic
956546970 3:70415204-70415226 TTGTAGACAAAATTTAGACTGGG + Intergenic
956946517 3:74229582-74229604 TTCAAAACAAAATTTGAGCTTGG + Intergenic
957555796 3:81762962-81762984 TTCTGAAAAAAGTTTAGGCTTGG - Intergenic
957804555 3:85130885-85130907 ATGAAAACAAATTTTATGCTAGG + Intronic
958658414 3:97033329-97033351 ATGTAGACAAAATTTAACCTAGG + Intronic
959612204 3:108307668-108307690 ATGTTAACAAAGTGGAAGCTGGG - Intronic
959884642 3:111485377-111485399 TCTTAAACAAACTTTAAGTTTGG - Intronic
963150481 3:142040723-142040745 TATTAAAAAAAGTTTTAGCTGGG - Intronic
963444275 3:145383540-145383562 TTATAAACATAGTTTATGCAAGG + Intergenic
964172094 3:153782976-153782998 TTTTAAACATAATTAAAGCTCGG - Intergenic
964918934 3:161872224-161872246 ATGTAAATAAAATTAAAGCTTGG + Intergenic
965978443 3:174656020-174656042 TTTTAAACAAATATTAAACTCGG - Intronic
966332453 3:178829413-178829435 TTGTAACAAAAGTTCAAGGTGGG - Intronic
969394628 4:6912093-6912115 GTATAAATAAAGTTTCAGCTGGG + Intronic
971626720 4:28930178-28930200 TAGTGAAAAAAGTTTCAGCTTGG - Intergenic
972442199 4:39105440-39105462 TTGAAAATAAATTTTAAGCCTGG - Intronic
972875242 4:43350681-43350703 ATGTAACCCAAGTTTCAGCTGGG - Intergenic
974464383 4:62235593-62235615 TTGTAAACTAAGTTTATGAGAGG + Intergenic
974590098 4:63937060-63937082 TTGGAAATAAAGCTTAATCTTGG + Intergenic
974711278 4:65599079-65599101 TTGAAAACAAAGTTTCAACAAGG + Intronic
974715451 4:65664433-65664455 TTGTAAACACAGATTAAAATGGG - Intronic
975110346 4:70616563-70616585 CAGAAAACAAAATTTAAGCTAGG + Intergenic
975602905 4:76121624-76121646 TTTTAAAAATAGATTAAGCTGGG - Intronic
976961581 4:90982495-90982517 TTTTAACCAAGGTTTAATCTAGG + Intronic
977049476 4:92110041-92110063 TTGTAGACAAAATTTATGATAGG - Intergenic
977323073 4:95544455-95544477 TAGTAAACATAGGTGAAGCTAGG - Intronic
978021326 4:103816938-103816960 TGGTAAATATAGTTTAAGCTTGG - Intergenic
978060349 4:104329122-104329144 TTAGAAACATATTTTAAGCTTGG + Intergenic
978714953 4:111830857-111830879 TTGGAACCAAAGTTGAAGTTTGG - Intergenic
981812194 4:148788897-148788919 TTGAAAACACAGTTTAATCCTGG + Intergenic
982243370 4:153323148-153323170 TTTTAAGCAAAGTTACAGCTAGG - Intronic
982374020 4:154667800-154667822 TTGGAAACAAGGTGTATGCTTGG - Intronic
983260763 4:165453678-165453700 TTGTAAAGAAAATTGAAGCTGGG - Intronic
983514173 4:168639343-168639365 TTGTCAAAATAGTTTAAACTGGG + Intronic
985768885 5:1796637-1796659 CTGCAACCAAAGTTTCAGCTTGG + Intergenic
986718769 5:10543824-10543846 TTGTAGACACAGTTTTATCTAGG + Intergenic
987524782 5:19033177-19033199 TTTAAAATAAAGTTTAAGCAAGG + Intergenic
987581375 5:19797791-19797813 TTATAAAAAAAATTCAAGCTGGG - Intronic
987818863 5:22936057-22936079 TTGAGAACAAATTTTTAGCTCGG - Intergenic
989414982 5:41163604-41163626 TTAAAAACAAAGTTCAGGCTGGG - Intronic
990998963 5:61763842-61763864 TAGTAAACAATGTTCAAGTTTGG + Intergenic
993260381 5:85650408-85650430 TTTTAAACAAAGTTTAAGATAGG + Intergenic
993591503 5:89800888-89800910 GTGTAAACAAAGTGTAAACTGGG + Intergenic
994050060 5:95352436-95352458 TGTTTAACAAAGTTTAAGCATGG + Intergenic
994735358 5:103547258-103547280 TTTTAAACAGATTTTAAGTTGGG - Intergenic
994868538 5:105313261-105313283 TTGTAATAAAAGTTGAAGCCTGG + Intergenic
995206892 5:109490060-109490082 TTGAAGACAAAGGTGAAGCTGGG + Intergenic
995511230 5:112911369-112911391 TTCTAAGCTAAGCTTAAGCTCGG + Intronic
996998968 5:129735373-129735395 TTGTAACCAAAATTTAGACTCGG + Intronic
997145842 5:131432321-131432343 TTGTAAATAAAGTTTTGGCTGGG + Intronic
998007896 5:138669361-138669383 TTTTAAACAAAGATTAGGATTGG + Intronic
998266388 5:140670750-140670772 GTGTAAACAAACTCTAAGCTAGG + Exonic
998793029 5:145786558-145786580 ATGTAATCAAGGTTTTAGCTGGG - Intronic
1000493246 5:161943288-161943310 TTCTAAACAAAATATTAGCTGGG - Intergenic
1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG + Intergenic
1002199262 5:177518092-177518114 TAGTAAAGAAAGCTTAGGCTGGG + Intergenic
1002199355 5:177518815-177518837 TAGTAAAGAAAGCTTAGGCTGGG + Intergenic
1004711742 6:18177784-18177806 TTGTAAATAAAGTTTTAATTGGG + Intronic
1004789264 6:19005884-19005906 TTGTACACAAATTTTAGGATGGG + Intergenic
1004895008 6:20139848-20139870 TTGTATAGAAAGTTAAGGCTGGG - Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006390627 6:33756157-33756179 TTTTAAAAAAATTTTAGGCTGGG - Intergenic
1009877687 6:69525673-69525695 GTGTAAATAAAGTATAAGCTGGG + Intergenic
1011038950 6:83009512-83009534 TTGAAAACAAAGGTTAAGTTTGG - Intronic
1011172410 6:84520508-84520530 TATTAAAAAAACTTTAAGCTAGG + Intergenic
1012738909 6:102988882-102988904 TTGTATAGATAGTTTAAGCCAGG - Intergenic
1014861662 6:126475526-126475548 TTATAAACAAACTATAACCTAGG + Intergenic
1015720872 6:136240227-136240249 TTCTAAGCAAAGCTTAAGATGGG + Intronic
1016259646 6:142152293-142152315 TTTTAAACAAATTTTAAAGTGGG + Intronic
1017166992 6:151418099-151418121 TAATAAAAAAAGTTTAGGCTGGG - Intronic
1018416208 6:163604138-163604160 ATGTAAAGAAAGTTCAAGGTTGG - Intergenic
1019012745 6:168855175-168855197 TTTTAAATAAAGTTTTAGCTGGG - Intergenic
1020451206 7:8322344-8322366 TTGCAATCAAAGTGTTAGCTGGG - Intergenic
1020687889 7:11318331-11318353 TTGTAAATAAAGTTTTACCGGGG + Intergenic
1021108344 7:16665537-16665559 TTGTAACCAAAATATAAGATTGG + Intronic
1021266099 7:18524607-18524629 TTGAAAATAAAGTTTATGTTTGG + Intronic
1021473140 7:21029347-21029369 TTGTAAACAATGTTAAACCTCGG + Intergenic
1021514070 7:21463701-21463723 TTGAAGACAGAGTTTGAGCTGGG + Intronic
1022933658 7:35149532-35149554 ATGTATACAAAGTTTCAGTTAGG + Intergenic
1023486129 7:40689086-40689108 TTTTAAAGAAACTTTAAGTTGGG - Intronic
1024953803 7:54894555-54894577 TTGTATAAAAAGTTTCAGCAAGG + Intergenic
1026703769 7:72671764-72671786 TTTTAAAAAAAGTTTAAAGTTGG - Intronic
1027531492 7:79339781-79339803 AAGGAAACAAAGTTTAAGCCAGG - Intronic
1027842748 7:83334764-83334786 ATGTAAACTAAATTTAAGGTTGG + Intergenic
1028396676 7:90376920-90376942 TTATAAATAAATTTTAAACTAGG + Intronic
1030652121 7:112127728-112127750 TTGTAAAGAAAGCCTAAGCTTGG + Intronic
1030848150 7:114447950-114447972 ATGAAAAAAAAGTTTAAGATAGG + Intronic
1032597529 7:133256329-133256351 TTGAAAACAACGTTAAAGATAGG - Intronic
1032743693 7:134765019-134765041 ATGAAAACAAAGTTCAGGCTGGG + Intronic
1032994750 7:137432502-137432524 TTGTAAGCAAACTGTATGCTAGG + Intronic
1033728861 7:144153027-144153049 TGGTACACAAACTTTAAGTTAGG - Intergenic
1036122558 8:6034151-6034173 TTAGAAACAAAATTTAGGCTGGG + Intergenic
1037335751 8:17790051-17790073 TTTTAAAAAAAGTTTCAACTGGG + Intronic
1045076260 8:98572321-98572343 ATGAACACAAAGTTTAATCTAGG - Intronic
1045431543 8:102119438-102119460 GTGGAAACAGAGTTTCAGCTGGG + Intronic
1045785168 8:105912539-105912561 TTCTTAAAAAAGTATAAGCTTGG + Intergenic
1045931763 8:107635330-107635352 GTGGAAGCAAAGTTTAAGTTTGG + Intergenic
1046115048 8:109775024-109775046 TTGTAAAGAACATTGAAGCTGGG - Intergenic
1048203128 8:132393476-132393498 TTGTAAATAAAGTTTTATTTTGG - Intronic
1051522652 9:18007149-18007171 TTGTTAACACAGTTTAAGCCAGG + Intergenic
1051561856 9:18451334-18451356 TTCTAAACTAATTATAAGCTAGG - Intergenic
1052191206 9:25664882-25664904 TTGAAGACCAAGTTTAATCTTGG + Intergenic
1052205654 9:25836484-25836506 TTGTATACACAGTTTAAACCAGG - Intergenic
1053032284 9:34790998-34791020 TTGTAGGCCAAGTTTAAACTTGG + Intergenic
1055906503 9:81300540-81300562 TTTTAAACAAAATTGAAGGTTGG + Intergenic
1056174336 9:84019502-84019524 TTTTAAAAAAAGATTAGGCTGGG - Intergenic
1059662233 9:116413355-116413377 TAAAGAACAAAGTTTAAGCTAGG + Intergenic
1061463998 9:130763520-130763542 TTGTAGACAAGATTTCAGCTGGG + Intronic
1203683089 Un_KI270757v1:4294-4316 ATCTAAACAAAGTTTCACCTCGG + Intergenic
1188022907 X:25177765-25177787 TTTCAAATAAATTTTAAGCTCGG + Intergenic
1188302255 X:28519466-28519488 TTGTCAACAATGGTTATGCTAGG - Intergenic
1189820208 X:44863007-44863029 TTGGAACCATAGTTTGAGCTTGG + Intergenic
1192063615 X:67857250-67857272 TTTTAAAAAACGTTTAAGTTGGG - Intergenic
1192265668 X:69535968-69535990 TTCTAAACAATGCTGAAGCTGGG - Intergenic
1194414411 X:93592775-93592797 TTGTATATAGATTTTAAGCTTGG - Intergenic
1195007858 X:100704312-100704334 TTTTAAACAACGTTTGAGGTGGG - Intronic
1195513261 X:105742320-105742342 TTTTAAAAAATGTTTAATCTTGG - Intronic
1197125506 X:122941412-122941434 TTAAAAATAAAGTTTAGGCTGGG - Intergenic
1197593836 X:128443054-128443076 TTGTAAACATAGTTTTAGGATGG + Intergenic
1197842502 X:130763716-130763738 TTTTAAAAAAAGTTCCAGCTTGG + Intronic
1197961570 X:132011940-132011962 TTGTAAACACTATATAAGCTTGG - Intergenic
1198536076 X:137588174-137588196 TTGCAAAAAAAGTTTAATTTCGG + Intergenic
1199022870 X:142902908-142902930 TTATATACAAAAATTAAGCTAGG - Intergenic