ID: 1110456667

View in Genome Browser
Species Human (GRCh38)
Location 13:75696868-75696890
Sequence AAAACCCACTCTCAGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110456667_1110456671 6 Left 1110456667 13:75696868-75696890 CCACTCTCCTGAGAGTGGGTTTT 0: 1
1: 0
2: 2
3: 14
4: 241
Right 1110456671 13:75696897-75696919 AGCAGCCAGTTGTGGCTATGAGG 0: 1
1: 0
2: 1
3: 25
4: 380
1110456667_1110456669 -2 Left 1110456667 13:75696868-75696890 CCACTCTCCTGAGAGTGGGTTTT 0: 1
1: 0
2: 2
3: 14
4: 241
Right 1110456669 13:75696889-75696911 TTCTCCAGAGCAGCCAGTTGTGG 0: 1
1: 0
2: 3
3: 29
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110456667 Original CRISPR AAAACCCACTCTCAGGAGAG TGG (reversed) Intronic
900982941 1:6056909-6056931 AAGACACTCACTCAGGAGAGGGG - Intronic
901671504 1:10858704-10858726 TAAACCCACAGTCTGGAGAGGGG + Intergenic
902826000 1:18974717-18974739 GAAGCCCACTCACAGGAGAGAGG - Intergenic
903843927 1:26265466-26265488 AATACCCAGTCACAGCAGAGAGG - Intronic
905750882 1:40462627-40462649 AAAACATTCACTCAGGAGAGAGG + Exonic
906980378 1:50622522-50622544 AAAAGTAACTCTCAAGAGAGTGG - Intronic
907546470 1:55263983-55264005 CAAAACCACCCTCATGAGAGAGG - Intergenic
907873980 1:58467871-58467893 TAAACCCAAATTCAGGAGAGAGG - Intronic
907979853 1:59471040-59471062 ATAAGCCTCCCTCAGGAGAGGGG - Intronic
911162118 1:94691791-94691813 AAAAAAAATTCTCAGGAGAGAGG + Intergenic
911883018 1:103265692-103265714 GAAACCCACCCCCAGGGGAGTGG + Intergenic
912660657 1:111526578-111526600 AAAACACTCTCCCATGAGAGTGG + Intronic
913128343 1:115814282-115814304 AAATCCCAATCTCAGGAGAAAGG - Intergenic
915194496 1:154179322-154179344 AACACACACTCACAGGGGAGAGG - Intronic
915912270 1:159922639-159922661 CACAGCCACTCCCAGGAGAGAGG - Intronic
919458791 1:197851602-197851624 AAAGCACACTCTCAAGAGTGGGG + Intergenic
919820062 1:201467007-201467029 AAAACCCACTGTCAAGAATGGGG + Intronic
919930574 1:202218768-202218790 ACAACAGACACTCAGGAGAGAGG - Intronic
920169667 1:204063690-204063712 AAAACCCATTCCCAAGAGTGGGG - Intergenic
921457556 1:215390076-215390098 AAAACCCATTTTCTGGGGAGAGG - Intergenic
921467699 1:215509779-215509801 AAACCCCATTCTCTGGAGACGGG - Intergenic
922545363 1:226452714-226452736 AAGACCTGCTCTCAGGACAGTGG + Intergenic
922816592 1:228453540-228453562 GAGACCCACAGTCAGGAGAGAGG + Intergenic
924447562 1:244148102-244148124 AGCACCCACTCTCAGCAAAGTGG - Intergenic
1063114012 10:3060535-3060557 GAAACCCAATCTCACCAGAGTGG - Intergenic
1063208464 10:3856874-3856896 AAAATCCAAACTCAAGAGAGCGG - Intergenic
1063343579 10:5291729-5291751 TAAACCCACTCTCACGATAATGG - Intergenic
1063355542 10:5395293-5395315 ACAGCCCACTCGGAGGAGAGGGG + Intronic
1064257806 10:13759190-13759212 AGAAATCACTGTCAGGAGAGGGG - Intronic
1064818675 10:19298257-19298279 AGTTCCCACTCTCAGGAGACTGG - Intronic
1065881054 10:30038176-30038198 AAAACCCAGTCCCAGGGGTGGGG - Intronic
1069113697 10:64477568-64477590 AGAACTCACTATCAGGAGAAGGG + Intergenic
1070671057 10:78377497-78377519 CAAACTCACTCCCTGGAGAGAGG - Intergenic
1072806692 10:98427999-98428021 AAAAACCACTATCAAGAGAGAGG + Intronic
1072814215 10:98488917-98488939 AAGAATCACTCTGAGGAGAGGGG - Intronic
1073038479 10:100581157-100581179 AAAACCCACCCTCAGGAGATTGG - Intergenic
1074188519 10:111116467-111116489 AAAGCCCACCCTGAGGGGAGAGG - Intergenic
1075476473 10:122739114-122739136 AAAACCCACACTCTGGGGAGTGG - Intergenic
1075678736 10:124317181-124317203 AATACCCACTAGCAGGAGAATGG - Intergenic
1075777548 10:124998243-124998265 ACAACCGAGTCTCAGGAGGGCGG - Intronic
1076787621 10:132758871-132758893 AAACCCGACGCTCAGGAGACAGG - Intronic
1078298925 11:10105242-10105264 AAAAGCCAGTCTTAGGAGAGAGG + Intronic
1078729802 11:13963986-13964008 AAACCCCACTCTCAGCCGAGCGG - Intronic
1078794115 11:14574615-14574637 AAAACTCACAATCAGGAGATGGG - Intronic
1083106207 11:60360888-60360910 CAAAACAACTCTCAGCAGAGAGG + Intronic
1083758017 11:64801812-64801834 CAAACCCCCTCTCAGGACTGGGG + Intronic
1084044647 11:66561643-66561665 ATCACACCCTCTCAGGAGAGTGG + Intronic
1084564110 11:69919951-69919973 GAAACTCACCCTGAGGAGAGAGG - Intergenic
1085044886 11:73346975-73346997 AAAGGCCATTCTCAGGGGAGTGG - Intronic
1086920035 11:92575739-92575761 AAGACCCCCTCTCAGGGAAGAGG - Intronic
1088792384 11:113237202-113237224 AGAACCAAATCTCAGGAGAAGGG - Intronic
1089166453 11:116481173-116481195 AAAAACAACTCTAAGGAGTGAGG + Intergenic
1090067748 11:123518105-123518127 AAACCCCACAACCAGGAGAGGGG - Intergenic
1091724340 12:2835051-2835073 AAAACCCAGTCCTAGAAGAGAGG + Intronic
1094344773 12:29455193-29455215 CAAACCCACTCTAAAGAAAGAGG + Intronic
1094578634 12:31712085-31712107 AAGACCCCATCTCGGGAGAGAGG - Intronic
1096142363 12:49253102-49253124 AAAAAAGACTTTCAGGAGAGTGG + Intronic
1096466577 12:51850030-51850052 GAAACAAGCTCTCAGGAGAGAGG - Intergenic
1096554177 12:52393318-52393340 CATCCCAACTCTCAGGAGAGGGG + Intergenic
1098037656 12:66321722-66321744 ACAACCCACCCTCAACAGAGAGG - Intronic
1098186994 12:67907363-67907385 AAAACCCATTTATAGGAGAGAGG - Intergenic
1100354198 12:93813742-93813764 ATACCCCCCTCTCAGGACAGTGG - Intronic
1102589094 12:113943811-113943833 AAAACTCTGTCTCAGGAGGGAGG + Intronic
1103273827 12:119695373-119695395 AAGACCCATTCTCAGGGCAGTGG + Intronic
1103480681 12:121248137-121248159 AATTCTCACTCTCAGGAGATGGG + Intronic
1103487545 12:121293595-121293617 AGACACCACTCTCAGGGGAGAGG - Intronic
1103845752 12:123901046-123901068 AAGAGCCACCCTCAGGAGAGAGG - Intronic
1108256761 13:48618613-48618635 TAAAAGCATTCTCAGGAGAGAGG + Intergenic
1110456667 13:75696868-75696890 AAAACCCACTCTCAGGAGAGTGG - Intronic
1110911868 13:80975841-80975863 AAAACCCACTCTCACAATAATGG + Intergenic
1113035205 13:106040475-106040497 AGATCCCACGCTCAGGAGACAGG + Intergenic
1114158715 14:20137495-20137517 AAAAAGCATTCTCAGCAGAGGGG + Intergenic
1115077451 14:29408777-29408799 AAAACTCACTATCATGAGAACGG - Intergenic
1115798700 14:36968299-36968321 ACCTCCCACTCTCAGTAGAGGGG - Intronic
1117788589 14:59314149-59314171 AATCCCAACCCTCAGGAGAGTGG - Intronic
1118168393 14:63360420-63360442 ACAGGCCACACTCAGGAGAGAGG - Intergenic
1119033570 14:71211313-71211335 AAAGCCAACTCTCAAAAGAGAGG - Intergenic
1119950377 14:78738462-78738484 AGACCCCACCCTCAGGACAGTGG + Intronic
1120277557 14:82396655-82396677 AAAGCCCACTCTCATGAGCCTGG - Intergenic
1121962477 14:98274239-98274261 AGAACCCTTTCTCAGTAGAGTGG + Intergenic
1124053555 15:26221285-26221307 TAAACCCAGTTCCAGGAGAGAGG + Intergenic
1124930479 15:34114818-34114840 AAAAGCAGCTCTCAGCAGAGAGG - Intergenic
1125379298 15:39070334-39070356 AAAAGTCACTCTAAAGAGAGAGG - Intergenic
1125735344 15:41921176-41921198 AAACACCACACTCAGGACAGCGG - Intronic
1126054127 15:44713461-44713483 AAAACCCACACACAGGTCAGAGG - Intronic
1126768599 15:52033314-52033336 AAAACCCACCCTCATCAGTGTGG + Intronic
1128531825 15:68457722-68457744 AAAAGGCACCATCAGGAGAGTGG + Intergenic
1132277379 15:100580592-100580614 AAGACCAACTCTCAGATGAGCGG - Exonic
1133448785 16:5885973-5885995 ACAACTCACTATCATGAGAGTGG - Intergenic
1135782794 16:25319952-25319974 AAAAACCAATCTCATAAGAGAGG + Intergenic
1137515210 16:49137471-49137493 AAAACCCACTCACAGGAAGATGG - Intergenic
1137550947 16:49437153-49437175 CAGGCCCACTCTCTGGAGAGTGG - Intergenic
1140315215 16:73889737-73889759 AAAACCTGCACTCAGGAGAAGGG - Intergenic
1140519483 16:75568980-75569002 GAAACTCACACTCAGGGGAGAGG - Intronic
1140883547 16:79221292-79221314 CAAACCCACTTTAGGGAGAGAGG + Intergenic
1142657915 17:1406504-1406526 AAAACCCAGGCTCAGCATAGTGG + Intergenic
1142785965 17:2222948-2222970 ATCACCCTCTCTCAGGGGAGAGG + Intronic
1142847340 17:2688526-2688548 ACAACAAACACTCAGGAGAGGGG + Intergenic
1143471449 17:7178331-7178353 AACTGCCTCTCTCAGGAGAGGGG - Intronic
1147548185 17:41419370-41419392 AGAACCCACTCTCAGCATCGGGG - Intergenic
1149857444 17:60095202-60095224 ACAAGCCACTATCAGGTGAGAGG + Intergenic
1152576285 17:81142714-81142736 AGAAGCCACTCCCAGGAGGGTGG - Intronic
1153059778 18:983033-983055 AAAGCACAGTCACAGGAGAGAGG - Intergenic
1153181126 18:2434918-2434940 CAAACCCACTCTCATGATAAAGG - Intergenic
1153757017 18:8294467-8294489 AGAACTCACTATCAGGAGAATGG + Intronic
1155073039 18:22332867-22332889 CCAGCCCACACTCAGGAGAGGGG - Intergenic
1155367489 18:25063328-25063350 AAAGCCCACCCTCAGGAGGGGGG - Intronic
1155716228 18:28947152-28947174 AAATACGCCTCTCAGGAGAGGGG + Intergenic
1155735172 18:29212871-29212893 ACAACCCATTCTCAAGAGAATGG + Intergenic
1156463374 18:37334039-37334061 AGAACGCACTTTCAGGAGAGTGG - Intronic
1157451053 18:47789515-47789537 AAAAACCACGCTCAGCACAGAGG + Intergenic
1158190179 18:54818703-54818725 AAGCCCCACAATCAGGAGAGAGG + Intronic
1158803082 18:60936316-60936338 GAAACCAACTCTCAGGAAGGAGG + Intergenic
1160555655 18:79723351-79723373 AACCACCACTCTCAGGAGGGTGG - Intronic
1161234017 19:3189151-3189173 AGAGTCCACTCCCAGGAGAGGGG - Intronic
1162011040 19:7815326-7815348 AAAACCCACAGTCCAGAGAGGGG + Intergenic
1163861657 19:19746167-19746189 GACACCCAGTGTCAGGAGAGGGG + Intergenic
1165402935 19:35613305-35613327 ATAACCCACTCCCAGGAGAAAGG + Intronic
1167189737 19:47976603-47976625 AAAACCCTCTCTAATGAGAAAGG + Intronic
1168403473 19:56099021-56099043 ACAAGCGGCTCTCAGGAGAGAGG + Intronic
927163124 2:20288914-20288936 AAAAACCACTCTCATAAGAAGGG - Intronic
928838990 2:35582783-35582805 AAAATACACTCTCAGGAAAATGG + Intergenic
930715791 2:54593115-54593137 GAAACCCACCCTCAAGTGAGTGG - Intronic
931585654 2:63824130-63824152 AAAACTCACTATCATGAGAACGG - Intronic
932068500 2:68591846-68591868 AGAACCCACTCTCAGGAGTCTGG - Intronic
932219017 2:69986021-69986043 AAAACTCACTGTCGGGACAGGGG + Intergenic
932897830 2:75660485-75660507 AAAACTAACTCTCAGGAAGGGGG - Intronic
933442769 2:82334413-82334435 AAACCCCAGACTCAGCAGAGAGG - Intergenic
935918429 2:107984443-107984465 ATAACATATTCTCAGGAGAGTGG + Intergenic
936112380 2:109675781-109675803 CAGACCCACCCTCAGCAGAGTGG - Intergenic
937466547 2:122137937-122137959 AGAACTCACTCTCACGAGAACGG + Intergenic
938928950 2:136069186-136069208 AACACACATTGTCAGGAGAGAGG + Intergenic
940973899 2:159922382-159922404 TAAACCAGCACTCAGGAGAGAGG - Intergenic
941392647 2:164933591-164933613 TAAACCCACTATCAGAAAAGGGG - Intronic
943222616 2:185130291-185130313 AAAACACACTCTGTGGGGAGTGG - Intergenic
943486750 2:188494731-188494753 AAAAGTCACGCTAAGGAGAGAGG - Intronic
944930396 2:204511879-204511901 AAATCCCAAACTCAGCAGAGGGG - Intergenic
945130445 2:206565718-206565740 ATAACCCACTCCTAGTAGAGGGG + Intronic
945618088 2:212098526-212098548 ACAACCCACTCTCATCAAAGTGG - Intronic
946055255 2:216895569-216895591 AAAGCCCTCTCTCCAGAGAGTGG + Intergenic
947346187 2:229191369-229191391 AACACCCTCTCTCAAGAGAAAGG + Intronic
947870757 2:233436556-233436578 AAAACCCACTCTCAGCCGGAGGG - Intronic
947928236 2:233939868-233939890 AAAACCCCCTCTCACAGGAGGGG - Intronic
948361982 2:237428367-237428389 AAGCCCCACTCTCTGGAAAGTGG + Intergenic
948973210 2:241445310-241445332 ACAACCCACTCACAAGAGAAAGG - Intronic
949056058 2:241928755-241928777 CACCCCCACTCACAGGAGAGGGG + Intergenic
949056163 2:241929134-241929156 CCACCCCACTCACAGGAGAGGGG + Intergenic
1169370627 20:5026527-5026549 AAAAAACACTATCAAGAGAGTGG - Intergenic
1169888687 20:10430615-10430637 AATACCCAGTCTCAACAGAGAGG + Intronic
1174299622 20:49571963-49571985 AAAAACCAGTCTCAACAGAGAGG + Intergenic
1174402503 20:50283509-50283531 GAAAGGCACTCCCAGGAGAGTGG + Intergenic
1176034162 20:63028336-63028358 AAAACCTGCTGTCAGGAAAGAGG - Intergenic
1177794256 21:25756440-25756462 AAGAACCACTTTCAGGAGAATGG - Intronic
1178584286 21:33859706-33859728 CAAACACACGCTCAGGAAAGTGG - Intronic
1184639799 22:45864510-45864532 GAAAGCCTCTCTCAGGAGTGGGG - Intergenic
953285286 3:41600622-41600644 AGAACCCCCATTCAGGAGAGAGG - Intronic
957602989 3:82362094-82362116 AAAACTTACTCTCAGAAGATAGG + Intergenic
959315681 3:104803595-104803617 AAATCCCACTCACAGAAAAGAGG + Intergenic
959693530 3:109224711-109224733 GAAAACAACTCTCAGCAGAGAGG + Intergenic
960235828 3:115280927-115280949 GAATCCCACTCTAAGGAGATGGG - Intergenic
961225872 3:125245292-125245314 AGAACTCACTATCAGGAGAACGG - Intronic
961685357 3:128626157-128626179 AACACCCACTCTCTTGAGACAGG + Intronic
962143496 3:132815921-132815943 AAAACCCACTATCAAGATATAGG + Intergenic
962855593 3:139341891-139341913 AAAAGCCACTCTGCAGAGAGAGG - Intronic
964731316 3:159868688-159868710 AATGCCCATTATCAGGAGAGAGG - Intronic
965741469 3:171879556-171879578 AAAATCCATTCTCAAAAGAGAGG - Intronic
966100799 3:176267333-176267355 TACACCCACCCTCAGCAGAGAGG - Intergenic
966531959 3:180990955-180990977 AAAACCCAGACTCAGGAAATTGG + Intergenic
966917341 3:184592363-184592385 ACAACCCAGTCTCTGGAAAGAGG + Intronic
967833961 3:193945297-193945319 AGAAGCCACCCGCAGGAGAGGGG - Intergenic
967929575 3:194681071-194681093 AAAAACCACTCTCATGAGCATGG + Intergenic
969390221 4:6887176-6887198 ATAACCAACCCTTAGGAGAGAGG - Intergenic
973719007 4:53704840-53704862 AAGACCCACACTCAGGCAAGGGG + Intronic
973798805 4:54455861-54455883 AAAGCCCATTCTCTGGAGACAGG - Intergenic
973903980 4:55507880-55507902 AGAACCCACTCTTAGGAAACTGG + Intronic
975851113 4:78573620-78573642 AAAATACACACTCAGGAAAGGGG + Intronic
976756877 4:88508290-88508312 ATAACCCAATCTAAGGAGTGTGG + Intergenic
981535029 4:145790852-145790874 AAAACCCAAGGTCAGGAGAAAGG - Intronic
981704958 4:147649253-147649275 AAAACCCACTCCCATGATAATGG + Intronic
982195018 4:152902758-152902780 AAATCCCACTTTTAGGAGAAAGG - Intronic
983641547 4:169948051-169948073 GAAAACCAATCTCAAGAGAGAGG + Intergenic
986364843 5:7019761-7019783 AACACCCACTGTCAGCAGAAGGG - Intergenic
986542878 5:8865578-8865600 CAAACCCGTTCTAAGGAGAGGGG + Intergenic
987271188 5:16310972-16310994 CAAACTCACTGTCAGGAAAGAGG - Intergenic
988634313 5:32966132-32966154 ACAACCCACTGTCAAGGGAGGGG + Intergenic
988634763 5:32970657-32970679 ACAACCCACTGTCAAGGGAGGGG + Intergenic
989455372 5:41637613-41637635 GGAAGCCGCTCTCAGGAGAGAGG - Intergenic
989577485 5:43001647-43001669 AAAACCAACTCTCAGCAATGTGG - Intergenic
990424356 5:55671297-55671319 AAAAACCATTCTCAGGAAAGAGG - Intronic
990537084 5:56733468-56733490 AAAACCCACCCAGAGTAGAGAGG - Intergenic
991029593 5:62068786-62068808 AAAACCCAGGCCCAGGAGAGGGG + Intergenic
992180112 5:74187823-74187845 AAAACACATTCTCAGCAGAAAGG + Intergenic
992660379 5:78954340-78954362 AAAACCGTCTCTAATGAGAGGGG + Intronic
993693450 5:91031582-91031604 AAAAAGAACTCTCAGGAGTGGGG - Intronic
994166872 5:96617824-96617846 AAAAAACACTCTTAGGAGAAAGG + Intronic
994178870 5:96742164-96742186 AACTCCCACTCTCAGGGGTGTGG - Intronic
995688219 5:114794803-114794825 AAACCCCACTCTCACAAAAGTGG + Intergenic
996487235 5:124050919-124050941 GAAAATCACTATCAGGAGAGAGG - Intergenic
997017394 5:129952640-129952662 AAAACGCACTCTCTGGAAACAGG - Intronic
997359231 5:133283982-133284004 GAAACTCACTATCATGAGAGTGG + Intronic
998867975 5:146524348-146524370 CAAACCCACTCTGGGGAGACAGG + Intergenic
999130755 5:149281444-149281466 AAAGCCCAGTCTGAGGAGGGTGG - Intronic
999720254 5:154394203-154394225 AAAACCCATTCTCTGGGTAGAGG + Intronic
999991090 5:157050585-157050607 TAAACCAACTCTTAGGAGAAAGG + Intronic
1004801050 6:19148456-19148478 AAAACACACCATTAGGAGAGTGG - Intergenic
1005283653 6:24301725-24301747 AAAAATCACTCTGAGGAGCGGGG - Exonic
1007698250 6:43747369-43747391 AATACCAACTCTGAAGAGAGTGG - Intergenic
1008102503 6:47407070-47407092 CAAACCCACTCTCATGATAATGG - Intergenic
1014198779 6:118586398-118586420 AAAACCCAATCCCAGGAAATTGG + Intronic
1015380188 6:132558467-132558489 GAAACCAACACTCAGGAGAAGGG + Intergenic
1016231746 6:141814800-141814822 AAAACTCACTTTCTGGAGGGAGG + Intergenic
1016403531 6:143705907-143705929 ATAACCCTCTCTCAAGAAAGTGG - Intronic
1016479556 6:144467475-144467497 TAAATCCACTCTCACTAGAGAGG - Intronic
1016752296 6:147644223-147644245 AAAACCCAATCAGAGGAGGGAGG + Intronic
1016786779 6:148019519-148019541 AAGTCACACTCTCAGGAGAACGG + Intergenic
1018699344 6:166414034-166414056 AAGACCCACACTCAGCATAGTGG - Intronic
1019504357 7:1383430-1383452 AACACCCGCCCACAGGAGAGTGG + Intergenic
1022718294 7:32918822-32918844 CAAACCCACTCTCAGGAGGGAGG + Intergenic
1022948037 7:35307160-35307182 AAAACAAACACACAGGAGAGCGG + Intergenic
1022971532 7:35521935-35521957 AAAACCTATTGTCAGAAGAGGGG + Intergenic
1023149399 7:37186500-37186522 AAAAGACACTCTCAAGAAAGTGG + Intronic
1023352765 7:39336594-39336616 AAAACCCACGCTGAGGAGGAAGG - Intronic
1024354109 7:48396593-48396615 AAAACCCACTAGGCGGAGAGAGG + Intronic
1029261658 7:99306789-99306811 AAAACCCTTTCTGAGGAGTGAGG + Intergenic
1029733260 7:102451543-102451565 AAAACCCGCACACAGGACAGTGG - Exonic
1031358634 7:120820153-120820175 AAAACCCACTAGGAGAAGAGAGG - Intronic
1035554231 8:553578-553600 AAAAACCACTTTCAGGGGAGTGG - Intergenic
1036794420 8:11744904-11744926 AGAACACACCCTCAGCAGAGTGG - Intronic
1037195243 8:16180822-16180844 AAAACCAACTCTCAGAAAGGAGG - Intronic
1039304563 8:36247688-36247710 AATATACACTCTCAGGAGTGTGG - Intergenic
1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG + Intergenic
1039781076 8:40786238-40786260 TAAATTCACTCTCAGCAGAGAGG - Intronic
1040625129 8:49138922-49138944 AAAACCAATTCTTAGGAAAGAGG + Intergenic
1042814621 8:72865043-72865065 AAAGGCCTCTCCCAGGAGAGTGG - Intronic
1043266346 8:78271358-78271380 AAAACCCATTTTCTGGGGAGAGG - Intergenic
1043411491 8:80002112-80002134 ATATCCAGCTCTCAGGAGAGAGG + Intronic
1044515705 8:93136034-93136056 AGAACCCAAACTCAGGACAGGGG + Intronic
1044631020 8:94278689-94278711 AAAAACGGCTCTCAGCAGAGAGG + Intergenic
1046773432 8:118138911-118138933 AATACCGACACTAAGGAGAGTGG + Intergenic
1047872055 8:129094775-129094797 AAAAGCCACTTTCAGGAGCAAGG + Intergenic
1048028221 8:130606288-130606310 AAATCCCACTCTGAGTAGTGTGG - Intergenic
1048105695 8:131406317-131406339 AAAGCCCACATTCAGGAAAGAGG - Intergenic
1049596277 8:143484976-143484998 AAAACCCACTCACTTCAGAGGGG + Intronic
1049664116 8:143835507-143835529 CAGCCCCACTCTCAGGAGACGGG + Exonic
1049919629 9:351217-351239 AAAACCTTCTCTCTGGAGAAAGG - Intronic
1053236792 9:36462385-36462407 ACAACCCATTCTCAGCACAGCGG + Intronic
1053708331 9:40778957-40778979 AAAAGCCACCCTCAAGACAGTGG - Intergenic
1054418240 9:64899747-64899769 AAAAGCCACCCTCAAGACAGTGG - Intergenic
1054930814 9:70633430-70633452 AAGACACAATCTCAGGAAAGTGG + Intronic
1058827142 9:108785005-108785027 AAGACCCACTGTCTGGAGAAGGG + Intergenic
1059328759 9:113521410-113521432 AAATCCCACTCCCTGGAGTGAGG + Intronic
1059548061 9:115199087-115199109 AAAGACCAATCTCAGGGGAGTGG + Intronic
1060962989 9:127694383-127694405 GAAAGCCACTCCCAGGAGATTGG - Intronic
1188495494 X:30779437-30779459 GAAAACGACTCTCAGCAGAGAGG - Intergenic
1189736885 X:44080554-44080576 AAATCCTACTCTCCGGACAGTGG - Intergenic
1198256637 X:134929820-134929842 AAAGCACACTCTCAAGAAAGGGG + Intergenic
1198360563 X:135891281-135891303 AAAAGACACTCTTAAGAGAGTGG + Intronic
1201560330 Y:15309490-15309512 AAGATCCACTCTCAGGGGAAGGG + Intergenic