ID: 1110457274

View in Genome Browser
Species Human (GRCh38)
Location 13:75703548-75703570
Sequence TAGGGTTGCTACAAAGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110457270_1110457274 1 Left 1110457270 13:75703524-75703546 CCAGGGGTAAGAGATGCTACCAC 0: 1
1: 0
2: 0
3: 22
4: 183
Right 1110457274 13:75703548-75703570 TAGGGTTGCTACAAAGATTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106
1110457269_1110457274 14 Left 1110457269 13:75703511-75703533 CCTCATGTGTAAACCAGGGGTAA 0: 1
1: 0
2: 7
3: 127
4: 809
Right 1110457274 13:75703548-75703570 TAGGGTTGCTACAAAGATTCAGG 0: 1
1: 0
2: 0
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110457274 Original CRISPR TAGGGTTGCTACAAAGATTC AGG Intronic
903686832 1:25137923-25137945 TAGGGTTGTTGCAAGGATTAAGG - Intergenic
904608315 1:31710993-31711015 TAGGGTTGCTGGAAGGATTAAGG + Intergenic
905533065 1:38697346-38697368 TGGGGTTATGACAAAGATTCTGG - Intergenic
905559516 1:38915439-38915461 TAGGGTTGCTGTGAAGATTATGG + Intronic
906541056 1:46586327-46586349 TAAGGTTTCTACAGAGACTCTGG + Intronic
912550392 1:110481683-110481705 CAGGACTGCCACAAAGATTCCGG - Intergenic
912608945 1:111023266-111023288 TAGAGTTGATAAAAAGTTTCAGG + Intergenic
913400385 1:118425363-118425385 TAGGGGTGGTACTCAGATTCTGG + Intergenic
916385335 1:164261032-164261054 TAAGTTTCCAACAAAGATTCAGG + Intergenic
919441593 1:197640580-197640602 TAGGGTTGATGTAAAGATTAAGG - Intronic
1065885993 10:30077533-30077555 TTGGGATGATACAAAGTTTCTGG - Intronic
1066145914 10:32558432-32558454 TAGAGTTTATACAAAGAATCTGG + Intronic
1070413998 10:76172059-76172081 GTGGGTTGCTAGAAAGAGTCTGG - Intronic
1071875696 10:89840600-89840622 GAGTGTTGCTATAAACATTCAGG + Intergenic
1075705988 10:124501292-124501314 TTGGGATGATACAAATATTCTGG + Intronic
1081024159 11:37988013-37988035 GTGGGTTGTTAAAAAGATTCTGG + Intergenic
1084296936 11:68218370-68218392 CAGGGTTGCTACAAGGATAAAGG + Intergenic
1089626703 11:119755532-119755554 AAGGGCTGCTGCAAAGCTTCCGG - Intergenic
1093656958 12:21705937-21705959 TAGTGTTGCTATAAAGACCCTGG - Intronic
1098048227 12:66424882-66424904 TAGGTTTGCTACACAGATCTTGG + Intronic
1098698747 12:73595235-73595257 TACACTTGTTACAAAGATTCTGG - Intergenic
1101728344 12:107406162-107406184 TGGGGTTGTTGCAAAGATTATGG + Intronic
1104436091 12:128757763-128757785 TTGAGTTGCTACAAAGCCTCAGG - Intergenic
1108045571 13:46381161-46381183 TAGTGCTGCTAGAAATATTCGGG - Intronic
1108441746 13:50460455-50460477 TTGGCTTGCTACAAATATGCTGG - Intronic
1110457274 13:75703548-75703570 TAGGGTTGCTACAAAGATTCAGG + Intronic
1114382884 14:22226819-22226841 TAGGGTTACTACAAAGGGTCAGG + Intergenic
1117953486 14:61105002-61105024 TAGGGTTGCTGCAAAGAAGACGG - Intergenic
1120073754 14:80132806-80132828 TGGGGTTGTTAAAAAGAGTCTGG + Intergenic
1120263948 14:82225240-82225262 TAGAGTTGCTATAAGGATTAAGG + Intergenic
1121579189 14:95013926-95013948 TTGAGTTGCTATGAAGATTCAGG + Intergenic
1127320950 15:57845702-57845724 AAGGGTGGTTACACAGATTCAGG - Intergenic
1131245701 15:90790736-90790758 GAGGGTTACTACCAAGAATCTGG + Exonic
1132984169 16:2755401-2755423 GAGGGTTTCTACATAGATTTAGG + Intronic
1133514148 16:6491654-6491676 TAGGGCTGCTGGAAATATTCAGG - Intronic
1135389822 16:22081800-22081822 AAGGGCTGCTACAAAGAATGAGG - Exonic
1138070335 16:53986716-53986738 TAGAGTTTATACAAAGACTCTGG - Intronic
1138274524 16:55723969-55723991 TAGGATTGCTATGATGATTCTGG - Intergenic
1140271117 16:73467089-73467111 TGGAGTTGTTATAAAGATTCTGG + Intergenic
1141211417 16:81983946-81983968 TAGGTTTTCTTCCAAGATTCTGG - Intergenic
1146575820 17:33990289-33990311 CAGGGTTGCTTTAAAGATTGAGG + Intronic
1151578825 17:74966324-74966346 GAGAGTTGCTACTAACATTCTGG - Intronic
1153004658 18:487015-487037 TAATGCTGCTACAAACATTCAGG - Intronic
1153537792 18:6120910-6120932 TAGCGCTGCTACAAACATTCTGG + Intronic
1158254133 18:55526656-55526678 CAGGATTGCTGCAAGGATTCTGG - Intronic
1159990242 18:74898610-74898632 TAGGTTGTTTACAAAGATTCAGG - Intronic
926058247 2:9789326-9789348 TAGGTTTGCTTGGAAGATTCTGG - Intergenic
926082919 2:10003354-10003376 TTGGGTTACTGCAAAGATCCAGG - Intergenic
929331055 2:40681537-40681559 TTGGGTTGGTTCAAAGTTTCTGG + Intergenic
931028909 2:58147994-58148016 TATAGTTGCTACAAACATTCTGG + Intronic
939150396 2:138465712-138465734 TAGGGTTGCTGGGAAGATTATGG - Intergenic
939625641 2:144473697-144473719 TAGGGTTGTTACAGAGGTGCAGG + Intronic
946819622 2:223616529-223616551 TAGCGGTGCTACACAGATACAGG + Intergenic
947522420 2:230857475-230857497 CAGTGCTGCTACAAACATTCTGG - Intergenic
1170885322 20:20335825-20335847 GAGAGTTGCTAGAAAGACTCGGG + Intronic
1173624258 20:44460107-44460129 TAGGGTTGCCATAAAAATTCAGG - Intronic
1175497215 20:59423424-59423446 TAGGGGTGTGACAAAGACTCAGG + Intergenic
1177759360 21:25385460-25385482 TAAGGTTGTTGCAAAGAGTCAGG - Intergenic
1182893631 22:33840594-33840616 TAGGGTTGCTGTAAAGATGAAGG - Intronic
1183142596 22:35957215-35957237 TAGGATTGTTACAAGGATTGAGG + Intronic
953987214 3:47453615-47453637 AAGGGTTGTTACAAGGATTCAGG - Intronic
955498904 3:59564657-59564679 GTGGGTTGTTACAAAGAGTCTGG - Intergenic
956768407 3:72504141-72504163 AAGGGTTCCTACACAGAATCAGG - Intergenic
959746573 3:109782164-109782186 TATGGTTGTTACAAAGAGACTGG - Intergenic
960283555 3:115801803-115801825 TAGGGCTTCTATAGAGATTCAGG + Intergenic
962303131 3:134261139-134261161 TCTGGTTGCTAAAAAGAGTCTGG - Intergenic
962767240 3:138576925-138576947 TTGGGTTGGTTCCAAGATTCTGG - Intronic
963326449 3:143868679-143868701 TTGGGTTCCTACAAAAATTCTGG + Intergenic
963444366 3:145384618-145384640 GTGGGTTGTTAAAAAGATTCTGG - Intergenic
964035169 3:152187116-152187138 TAGGATTGCTATGAAGATACAGG + Intergenic
964814207 3:160699413-160699435 TAGGGTTGCCAAAAACATACAGG - Intergenic
967531943 3:190558231-190558253 TAGGGCTTCTACAAACATGCAGG + Intronic
967537419 3:190622931-190622953 TAGGGTTCCTATATAGCTTCTGG - Intronic
967602558 3:191406705-191406727 TATGGTTGTTAAAAAGAGTCTGG - Intergenic
968246194 3:197151733-197151755 CAGGGTTGCTATTAAGATACTGG + Intronic
975201816 4:71598905-71598927 CAGGGTTTCTACAAAGTTTAGGG + Intergenic
979126806 4:116982976-116982998 GAGGGTTGTTAAAAAGAGTCTGG - Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
980989475 4:139726800-139726822 TAGTGTTGCTACCAATATGCTGG + Intronic
981509463 4:145539920-145539942 TTGGGTTGCTGGAAAGAATCTGG - Exonic
990511333 5:56492079-56492101 TAGGTTTGCTGCACAGTTTCAGG - Intergenic
999659348 5:153842688-153842710 TCTGGTTGCTAAAAAGAGTCTGG + Intergenic
1003126051 6:3356640-3356662 CAGGGTTACAACAAAGCTTCAGG - Intronic
1003194753 6:3904541-3904563 TTTGGTTACTACAAAGATGCTGG + Intergenic
1004439214 6:15631608-15631630 CAAGCTTGCTACAAACATTCTGG + Intronic
1006209126 6:32377755-32377777 TAGGCTTGAGACACAGATTCTGG - Intergenic
1009526188 6:64749087-64749109 TAACTTTGCTCCAAAGATTCAGG + Intronic
1010254082 6:73738328-73738350 GAGGCTTGCTTTAAAGATTCTGG - Intronic
1012901072 6:105006958-105006980 TACAGTTGTTACAAATATTCTGG - Intronic
1013260780 6:108439618-108439640 TAGGGGGGCTTCAGAGATTCTGG + Intronic
1013700945 6:112768750-112768772 AAGGATTGGTACAAAGAATCAGG - Intergenic
1014876071 6:126661739-126661761 TAGGGATCCTACAAAAAGTCAGG + Intergenic
1016630577 6:146225257-146225279 TATGGTAGCTAAAAAGATTAAGG + Intronic
1019821122 7:3243511-3243533 TAGGGGTGTTGCAAAGATTGAGG - Intergenic
1024454332 7:49585822-49585844 TAGGGTTTCTGCTTAGATTCTGG + Intergenic
1026762010 7:73133945-73133967 TGGGGTTGTTATAAGGATTCTGG - Intergenic
1026859334 7:73775225-73775247 CAATGTTGCTACAAACATTCAGG - Intergenic
1027038351 7:74942769-74942791 TGGGGTTGTTATAAGGATTCTGG - Intergenic
1027085212 7:75258713-75258735 TGGGGTTGTTATAAGGATTCTGG + Intergenic
1031765854 7:125776389-125776411 TAGGCTTGCTACACAGTTTTCGG + Intergenic
1035387052 7:158480148-158480170 TAGGGTTGCCACAAGGCTTCAGG - Intronic
1037855055 8:22366051-22366073 TAGGGTTATTACAAAGATGAAGG + Intergenic
1038014308 8:23500513-23500535 TAGAATTGCTAGAATGATTCTGG + Intergenic
1042370309 8:67983900-67983922 TAGGGTTGCTGTGAAGATTGAGG + Intronic
1045554840 8:103206105-103206127 TAGGGTTGGTGGAAAGATTTAGG + Intronic
1046798416 8:118397715-118397737 GAGGGTTGTCACAAAGATTAAGG - Intronic
1052464493 9:28813257-28813279 TAGGGTTGGTACTGAGTTTCAGG - Intergenic
1052592206 9:30513205-30513227 TATGCTTGCTTCAAAGAGTCTGG + Intergenic
1056194286 9:84214376-84214398 AAGGGTAGCTACAAAGACTGAGG + Intergenic
1059517102 9:114906213-114906235 CAGAGTTGCTGCAAAGATTAAGG - Intronic
1189086841 X:38034398-38034420 TAGGGTTGTTGTAAAGATTAAGG + Intronic
1189960124 X:46316378-46316400 TTGGAATGGTACAAAGATTCTGG + Intergenic
1190947402 X:55109258-55109280 TAGGGTCCCTTCTAAGATTCAGG + Intronic
1196194804 X:112828389-112828411 TAGGGTTGTTATAAAGATTAAGG + Intronic
1199526280 X:148795406-148795428 TCAGGATGCTACAAAGTTTCAGG - Intronic