ID: 1110461632

View in Genome Browser
Species Human (GRCh38)
Location 13:75751570-75751592
Sequence GCTCCCAGAACGACACCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110461632_1110461636 6 Left 1110461632 13:75751570-75751592 CCAGGTGGTGTCGTTCTGGGAGC 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1110461636 13:75751599-75751621 TTAAGCTTTGTAAGGCCTTTAGG 0: 1
1: 0
2: 1
3: 13
4: 141
1110461632_1110461634 -2 Left 1110461632 13:75751570-75751592 CCAGGTGGTGTCGTTCTGGGAGC 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1110461634 13:75751591-75751613 GCCTTGGTTTAAGCTTTGTAAGG 0: 1
1: 0
2: 1
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110461632 Original CRISPR GCTCCCAGAACGACACCACC TGG (reversed) Intronic
900087647 1:906039-906061 CCACCCAGATCCACACCACCAGG + Intergenic
900360897 1:2288592-2288614 ACTCCCAGAGCAAAACCACCTGG - Intronic
900517546 1:3090181-3090203 GCACCCCGAACGCCACCACGGGG + Intronic
902097003 1:13954306-13954328 GCTCCCAGAATGTCATCAGCTGG - Intergenic
902825442 1:18970397-18970419 CCTCCCAGAACGAGAGCACCTGG + Intergenic
908571312 1:65413478-65413500 ACTCCAAGAACAAAACCACCAGG + Exonic
910224642 1:84923967-84923989 GATCCCAGAATGAAACCAGCAGG + Intergenic
915332927 1:155124888-155124910 GCTCCCAGCACGTCACCCGCAGG - Intergenic
922663566 1:227450331-227450353 GCTCCCCCATCGACCCCACCAGG - Intergenic
1070582469 10:77732587-77732609 TCTGCAAGGACGACACCACCTGG - Intergenic
1077130782 11:971412-971434 GCTCCCAGGAAGACGCCACGAGG - Intronic
1083646592 11:64174981-64175003 GCTCCAGGAACGAAACCCCCTGG - Intergenic
1102234560 12:111286168-111286190 GCGCCCAGAATGCCAGCACCTGG + Intronic
1106586044 13:31056823-31056845 GCTCCCAGATGGCCACCAGCTGG - Intergenic
1108495513 13:51020591-51020613 TCGCCCCCAACGACACCACCAGG - Intergenic
1109945359 13:69424556-69424578 GCTCTCAGAAAGAAACAACCTGG + Intergenic
1110461632 13:75751570-75751592 GCTCCCAGAACGACACCACCTGG - Intronic
1117937658 14:60925353-60925375 GCTTCCAGAACCCCACCCCCAGG - Intronic
1118744065 14:68761524-68761546 CCTCCCAGGACAACACCTCCAGG + Intergenic
1137855983 16:51795117-51795139 GCTCCCAGAATGCCAAGACCAGG - Intergenic
1141134608 16:81457389-81457411 CCTCCCAGAATCCCACCACCTGG + Intronic
1142987668 17:3706567-3706589 GCTCCCACATCACCACCACCTGG + Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1150823775 17:68457268-68457290 GCTCTCAGGACGACACCCCTGGG + Intronic
1151155673 17:72121916-72121938 GCTCCCGGAACGGCAACTCCCGG - Intronic
1152272549 17:79333589-79333611 GCTCCCAGAACAAAAGCACCTGG + Intronic
1152708872 17:81860321-81860343 GCTCACAGAACTCCACCAGCAGG + Exonic
1157926163 18:51768224-51768246 GCTCCCAGAACTACAGCCCAGGG - Intergenic
1158608815 18:58919997-58920019 TCTGCAAGGACGACACCACCTGG - Exonic
1160271230 18:77386180-77386202 GCTCCCAAAAGGAAACCTCCAGG - Intergenic
1165596739 19:37015642-37015664 GGTCCCACAACTACACCAGCAGG + Intronic
927576274 2:24204363-24204385 GCTCCCAGAGCTACACCACCAGG - Exonic
935769621 2:106404906-106404928 GCTGCCAGAATAAAACCACCAGG - Intronic
935859416 2:107311842-107311864 GTTCCCAGACCAGCACCACCTGG - Intergenic
935910472 2:107891022-107891044 GCTGCCAGAATAAAACCACCAGG + Intergenic
935968596 2:108507863-108507885 GCTGCCAGAATAAAACCACCAGG + Exonic
936132264 2:109856165-109856187 GCTGCCAGAATAAAACCACCAGG + Exonic
936149697 2:110008608-110008630 TCTGCAAGGACGACACCACCCGG - Intergenic
936194981 2:110362761-110362783 TCTGCAAGGACGACACCACCCGG + Intergenic
936212433 2:110515320-110515342 GCTGCCAGAATAAAACCACCAGG - Exonic
936421573 2:112369887-112369909 GCTGCCAGAATAAAACCACCAGG - Intergenic
936531629 2:113280063-113280085 TGTCCCAGAACAACCCCACCAGG - Intergenic
937726107 2:125168319-125168341 ATGCCCAGAAAGACACCACCGGG - Intergenic
937919952 2:127121982-127122004 GCTGCCAAAATGACCCCACCTGG - Intergenic
939535246 2:143420032-143420054 GCTCCCAGAATCACACTACATGG + Intronic
942449879 2:176102064-176102086 ACACCCAGAACAACTCCACCTGG - Intergenic
948476743 2:238225473-238225495 ACTCCCAAGACGACACCATCAGG + Exonic
1168763534 20:366128-366150 CTTCCCAGAACTACAACACCAGG - Intronic
1171750710 20:29045763-29045785 GCTCTGAGAAAGACAGCACCGGG - Intergenic
1172093022 20:32446920-32446942 GCTGCCACAGGGACACCACCAGG - Exonic
1173339662 20:42141895-42141917 GCTCCCAGAAGGGCACCTACAGG + Exonic
1176048324 20:63103837-63103859 GCTCCCAGGAAGACACCCCCAGG + Intergenic
1176314051 21:5225159-5225181 GCTCTGAGAAAGACAGCACCGGG + Intergenic
1178695992 21:34792960-34792982 CCACCCAGGATGACACCACCTGG + Intronic
1180391867 22:12291278-12291300 GCTCTGAGAAAGACAGCACCGGG + Intergenic
1180407878 22:12573478-12573500 GCTCTGAGAAAGACAGCACCGGG - Intergenic
1180583055 22:16859755-16859777 TCTGCAAGGACGACACCACCTGG + Intergenic
1181515617 22:23410111-23410133 ACTCCCTGAAGGACACCACCTGG + Intergenic
1181568398 22:23753098-23753120 GCCCCCAGCACGTCACCATCAGG - Exonic
1183352869 22:37343699-37343721 GCTCCCAGACCCACCCCCCCCGG + Intergenic
954912317 3:54121064-54121086 GCTCCTAGCCGGACACCACCTGG + Intergenic
962873656 3:139519420-139519442 GCTCCCAGTAGCCCACCACCCGG + Intronic
969250469 4:5964910-5964932 ACACCCAGAAAGCCACCACCAGG - Intronic
969493302 4:7512161-7512183 TCTCCCTTAACGACACCGCCTGG - Intronic
969660708 4:8525816-8525838 GCTCCCGGATCCACACCACTGGG - Intergenic
985433068 4:189900193-189900215 GCTCTGAGAAAGACAGCACCGGG - Intergenic
985697507 5:1349069-1349091 GAGCCCAGAACGCCACCTCCTGG + Intergenic
985778267 5:1856772-1856794 GCTCCCAGGCCGGCACCCCCGGG + Intergenic
995225000 5:109690907-109690929 GAGCCGAGAACGACCCCACCGGG - Intronic
1007828534 6:44620226-44620248 GCTTCCAGAAGCTCACCACCAGG + Intergenic
1019690276 7:2406585-2406607 GCTCCCAGAACATGACCAGCTGG + Intronic
1019930148 7:4217432-4217454 ACTCGGAGAACCACACCACCCGG + Intronic
1020407681 7:7855434-7855456 GCCCCAAGACCAACACCACCTGG + Intronic
1020883594 7:13794687-13794709 GCTCCCAGAATGTCATCAGCTGG - Intergenic
1023725442 7:43138439-43138461 ACTCCCAGAAGAAAACCACCCGG - Intronic
1037466815 8:19169071-19169093 GCTCACAGATAGACAACACCAGG + Intergenic
1039047804 8:33466158-33466180 TCTCCCAGAACCACCGCACCTGG - Intronic
1047432921 8:124808193-124808215 CCTCCCACAACCTCACCACCAGG - Intergenic
1049670579 8:143867859-143867881 GGTCCCAGAAAGAGACCACCTGG + Exonic
1050650126 9:7766981-7767003 CCTCCCAGGAATACACCACCAGG - Intergenic
1053722221 9:40958245-40958267 GCTCTGAGAAAGACAGCACCAGG - Intergenic
1054343749 9:63893749-63893771 GCTCTGAGAAAGACAGCACCGGG + Intergenic
1056462045 9:86818023-86818045 GCCACCAGGAAGACACCACCGGG + Intergenic
1061016165 9:127981797-127981819 GCTCCCAGCTCAAGACCACCAGG + Intergenic
1187102239 X:16205626-16205648 GCTCCCAGAACATTACCAGCAGG + Intergenic
1189000357 X:36937608-36937630 GCTCCCAGAATGCCATCAACTGG + Intergenic
1192822103 X:74656628-74656650 GCCCACAGAATGACACCACTTGG + Intergenic
1192903237 X:75522564-75522586 GCTCCCAGAAGGAGAGCACAAGG + Intronic
1200311998 X:155087218-155087240 GATGCCAGAACGATCCCACCCGG + Intronic