ID: 1110461853

View in Genome Browser
Species Human (GRCh38)
Location 13:75753765-75753787
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 20276
Summary {0: 14, 1: 381, 2: 3819, 3: 7199, 4: 8863}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110461853 Original CRISPR GACTCACAGTTCCACAGGAC TGG (reversed) Intronic
Too many off-targets to display for this crispr