ID: 1110463842

View in Genome Browser
Species Human (GRCh38)
Location 13:75778556-75778578
Sequence CGGTGCTTACATCTGCTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110463842_1110463846 23 Left 1110463842 13:75778556-75778578 CCCTTAAGCAGATGTAAGCACCG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1110463846 13:75778602-75778624 AGTCAACACTTGAAAATCATTGG 0: 1
1: 0
2: 1
3: 17
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110463842 Original CRISPR CGGTGCTTACATCTGCTTAA GGG (reversed) Intronic
901397694 1:8993366-8993388 TGGTGCTTACAAATGCTCAAAGG - Intergenic
912781948 1:112559152-112559174 CTTTGCTTACATTTGCTAAATGG - Intronic
913711276 1:121486299-121486321 CTGTGCTTACTTCTGCATAGTGG - Intergenic
914802934 1:150974061-150974083 CAGAGCTTCCATGTGCTTAACGG - Intronic
915670816 1:157487130-157487152 GTGTGCTTATATCTGTTTAAAGG + Intergenic
919359408 1:196571934-196571956 AGGTGTTAAAATCTGCTTAAAGG + Intronic
921872647 1:220157473-220157495 CCCTGCTAACATCTGCCTAAGGG + Exonic
922712081 1:227841912-227841934 TGGTGCTGGCATCTGCTTCAGGG + Intronic
923735517 1:236603315-236603337 CGGTGCTTCAAACTGCTCAAAGG + Exonic
924058886 1:240151512-240151534 CGGAGCTTACATTTTCTCAAAGG - Intronic
924395929 1:243620708-243620730 CGGTGCTTTCATCTCCATCAAGG - Intronic
1066623179 10:37379805-37379827 CAGTGCTTTCATCTGCATGATGG - Intronic
1067762213 10:49056907-49056929 CGGTGCTGGCATCTGCTTCTGGG + Intronic
1068270079 10:54711090-54711112 TGGTAATTACATCTGCTAAAAGG + Intronic
1068693382 10:59940962-59940984 TAGTGCTGACATCTGCTTATGGG + Intergenic
1074787383 10:116852867-116852889 AGATGATTACATCTGCATAAGGG + Intronic
1075267158 10:121011088-121011110 CTGTGCTAACATTTTCTTAAAGG - Intergenic
1081636189 11:44723804-44723826 CGGTCCTTACATCTGTAAAATGG - Intergenic
1095321145 12:40828727-40828749 CGGTGCTTTCCTCTGCTTCTGGG - Intronic
1100017635 12:90030755-90030777 TGGTGATTTCATCTGCTTTATGG - Intergenic
1101138143 12:101766845-101766867 CAGGGCTTACATTTGCTCAAGGG + Intronic
1101432148 12:104635419-104635441 CGGCAATTACATCTTCTTAAGGG - Intronic
1110463842 13:75778556-75778578 CGGTGCTTACATCTGCTTAAGGG - Intronic
1116549750 14:46221867-46221889 CTGTGCATCCATCTGCTTTAGGG - Intergenic
1138226987 16:55304407-55304429 TGGTGCTAGCATCTGCTTCAGGG + Intergenic
1138984797 16:62315276-62315298 TGGTGTTTACATCTTCTTGATGG - Intergenic
1143405498 17:6674827-6674849 CGGTGCTCACCTCTGCTTCCAGG - Intergenic
1146534932 17:33641852-33641874 CAGTGCCTTCATCTGCATAATGG + Intronic
1148257773 17:46151186-46151208 CGATGCTTACAACAGCTTACAGG + Intronic
1151077056 17:71286234-71286256 TGGTGTTTCCATCTGCCTAATGG - Intergenic
930550016 2:52821876-52821898 AGGTGCTTACATTTTCTCAATGG - Intergenic
931877696 2:66531717-66531739 ATGTGCTTACATCTGCTGATTGG + Intronic
939733654 2:145816580-145816602 TGGTTCTTTCATCTTCTTAATGG + Intergenic
941163013 2:162056231-162056253 CGGAGCTTACATCCAATTAAGGG - Intronic
945141682 2:206693312-206693334 CATTGCTGACATCTGCTGAAAGG + Exonic
1169228581 20:3871670-3871692 GGGTGCTATCAGCTGCTTAATGG - Exonic
1169714849 20:8603828-8603850 GGGTGATTTCAACTGCTTAATGG + Intronic
1174444507 20:50581439-50581461 CGGCGCTTACCTCTGCTACAGGG + Exonic
1175053281 20:56174830-56174852 CTCTGCTTACATCTGCTAACTGG + Intergenic
1179913799 21:44463711-44463733 CGGTGCTCACATCTCCCTGACGG + Intergenic
1182015478 22:27035840-27035862 CGGTGTTCACATCTGTTAAATGG - Intergenic
950234718 3:11308732-11308754 CGGTGCTGAGATCTGCTGAGAGG + Intronic
952234789 3:31467949-31467971 CTGTTCTTACATCTGCTTGAGGG + Intergenic
955045796 3:55358391-55358413 CTGTGCTCACATCTGCTTAGTGG - Intergenic
955171835 3:56573682-56573704 CAGTGCTGACATCTTCTGAAGGG + Intronic
956135621 3:66095741-66095763 CGGTGATTACACCTCCTTTAAGG - Intergenic
956468183 3:69539795-69539817 CAGTGCTTACATTTCCTAAAAGG - Intronic
962923126 3:139968565-139968587 AGGTGCTGACATCTGCTTTCTGG - Intronic
970889588 4:21028019-21028041 CTGTGAGTAGATCTGCTTAAGGG - Intronic
975665732 4:76733150-76733172 CAGTGCTTATCTCTGCTGAAGGG - Intronic
980878130 4:138682851-138682873 TGGTGCTGGCATCTGCTCAACGG - Intergenic
983677528 4:170313235-170313257 AGGTACGTACAACTGCTTAATGG - Intergenic
984364983 4:178786699-178786721 CAGTGCTTAAATCTGCTTTTTGG - Intergenic
986339953 5:6780377-6780399 CAGTGCATACATCTGCAGAAAGG + Intergenic
996213629 5:120841217-120841239 AGGTGCTCACCTATGCTTAAAGG + Intergenic
1001498382 5:172207206-172207228 CTGTGCTGACATCTGCTGAGTGG + Intergenic
1014266939 6:119289801-119289823 CTGTGCTTAAATCTGTTTGAAGG + Intronic
1018385232 6:163297244-163297266 TGGTGCTTACTGGTGCTTAAAGG + Intronic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1037450941 8:19014559-19014581 AGGTGCTTGGATCTACTTAACGG - Intronic
1038034697 8:23677190-23677212 CTGTGTGTACATGTGCTTAAAGG + Intergenic
1038793172 8:30686741-30686763 CAGTGCTTACATCTGTACAATGG + Intronic
1041319881 8:56602157-56602179 GGGTGCTTACAGCTGATTGATGG + Intergenic
1055545567 9:77369300-77369322 GAGTACATACATCTGCTTAATGG - Exonic
1056098163 9:83275137-83275159 CTGTGCTTTCAGCTGCTTATTGG - Intronic
1061778962 9:132984697-132984719 CAGTGCTCATATCTGCTAAACGG - Intronic
1185782509 X:2861710-2861732 AGGTACTTACATCTTCTGAACGG - Exonic
1188505305 X:30876219-30876241 GTGTGTGTACATCTGCTTAAGGG - Intronic
1190522290 X:51292765-51292787 TGGTGCTTACAGCTGCTTCAAGG - Intergenic
1190525515 X:51325908-51325930 TGGTACTTACAGCTGCTTCAAGG - Intergenic
1190543965 X:51505722-51505744 TGGTACTTACAGCTGCTTCAAGG + Intergenic