ID: 1110467228

View in Genome Browser
Species Human (GRCh38)
Location 13:75815660-75815682
Sequence GGAAAGATGTTTGTTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110467228 Original CRISPR GGAAAGATGTTTGTTGAAAC TGG Intronic
901909482 1:12444135-12444157 AGAAAGATGTTTTCTGAAGCTGG - Intronic
903176225 1:21583078-21583100 AGAAAGATGTGTTTTTAAACAGG + Intergenic
907348235 1:53802493-53802515 TTAAAAATTTTTGTTGAAACAGG - Intronic
907949112 1:59163888-59163910 GGAATGATGTTTTTTCAAATTGG + Intergenic
908305359 1:62808629-62808651 GGAAAGACATTTGTAGAAAAAGG + Intronic
908512189 1:64858237-64858259 GGACAGATGTTAGTAGGAACAGG + Intronic
915321193 1:155057312-155057334 GGAAATATGTTTGTGGAGCCGGG + Exonic
916014912 1:160741411-160741433 GGAAAGGTGTGTGGTGAAGCGGG + Intronic
917498665 1:175565900-175565922 GGAAGGATGTGAATTGAAACTGG + Intronic
923146913 1:231204452-231204474 GGATAAATGGTTGTTGAATCGGG + Intronic
1063131808 10:3184812-3184834 GGAAAAATGTTCGTTGAAGCAGG - Intergenic
1063526236 10:6788954-6788976 GGAAGGATGCTTGTTGAAGTCGG + Intergenic
1065313124 10:24435428-24435450 TGTAAGATGATTGTTGTAACTGG - Intronic
1067422396 10:46165178-46165200 GGACAATTGCTTGTTGAAACAGG + Intergenic
1067492392 10:46723221-46723243 AGCAAAATGTTAGTTGAAACAGG - Intergenic
1067602273 10:47617161-47617183 AGCAAAATGTTAGTTGAAACAGG + Intergenic
1067983232 10:51111538-51111560 GGAAAGATGATTGATGCAAAGGG + Intronic
1068580238 10:58731034-58731056 GCAAAGATGTTATCTGAAACTGG - Intronic
1072392230 10:94998664-94998686 AGAAAGTTGTTTACTGAAACTGG + Intergenic
1074512678 10:114131315-114131337 GGAAAGTAGGTTGTTGAAAGAGG - Exonic
1076153461 10:128184091-128184113 GGAATGTGGTTTGTTGAAAATGG - Intergenic
1077575511 11:3379934-3379956 GGAGAGATGTTTGTAGCAAGAGG - Intergenic
1078277286 11:9861677-9861699 AAAAAAATGTTTCTTGAAACAGG + Intronic
1082919646 11:58479326-58479348 GGATAGATGTATGTATAAACAGG + Intergenic
1083174737 11:60942441-60942463 GGATAAATGTTTGCTGAAATGGG + Intronic
1085208857 11:74755995-74756017 GGAAAGATGTGAGTAGAAACTGG + Intronic
1085366624 11:75952834-75952856 GGAAAGATTTTTGATGCTACTGG + Intronic
1086919521 11:92570518-92570540 GGATGGATGGCTGTTGAAACTGG - Intronic
1087012079 11:93523936-93523958 GGAAAGATTCTAGCTGAAACAGG + Intronic
1088552339 11:111025753-111025775 GGCAGGATTTTTGCTGAAACTGG - Intergenic
1088930148 11:114342980-114343002 GAAAAGATTTATGTTGAAAGTGG + Intergenic
1089774539 11:120827127-120827149 GGAAGGAAGCTTGTTGAAAGAGG + Intronic
1090479346 11:127054483-127054505 GGAGATATGTTTGTTAGAACAGG - Intergenic
1092957203 12:13561729-13561751 GGAAAGTTCTTGGTTCAAACTGG + Exonic
1093817360 12:23566035-23566057 GGAACCATTTTTATTGAAACAGG - Intronic
1094003132 12:25718070-25718092 GGAAACATGTTGATTGGAACTGG + Intergenic
1094151866 12:27293687-27293709 AGAAAGATGTATGTTGAACTTGG - Intronic
1095632127 12:44390094-44390116 GTAAAGATGTTTATTAAAGCTGG - Intergenic
1097099718 12:56578641-56578663 GGAAAGGATTTTGTTAAAACAGG + Intronic
1098448619 12:70593691-70593713 GGAAAGATATTTGAGGACACCGG - Intronic
1100287024 12:93176499-93176521 TGAAAGAGTTTTGTTGAAGCAGG + Intergenic
1101286620 12:103320160-103320182 GAAAGGATGTTTGTTGAAAGAGG - Intronic
1102484838 12:113248535-113248557 GATAAAATGTTTGTGGAAACTGG + Intronic
1102868612 12:116394400-116394422 GGAAGGATATTTGTTGAGCCAGG + Intergenic
1103971467 12:124675466-124675488 GGAAAGATGTTCGTGGCAGCGGG + Intergenic
1104656605 12:130578301-130578323 AGAAAGATGATTCTGGAAACGGG - Intronic
1104921692 12:132293958-132293980 GGCAAGATCTTTGGTCAAACAGG - Intronic
1106220652 13:27743876-27743898 GTAAAGATGAATGTTGAAAATGG - Intergenic
1106474628 13:30088019-30088041 GGAAAAAAGTTTGTTAAATCTGG - Intergenic
1107183298 13:37487173-37487195 GAAAAGATGTATGTGGAAACTGG - Intergenic
1108049928 13:46423480-46423502 GGAAAGATCTTAGTTGTATCTGG + Intronic
1108244903 13:48504390-48504412 GAAAGCCTGTTTGTTGAAACAGG - Intronic
1109177124 13:59169922-59169944 GGAAAGATCTTTTTTAAAATTGG - Intergenic
1109338904 13:61029104-61029126 GGAAAGGTGTTTGGTGAGAGAGG - Intergenic
1109542447 13:63796767-63796789 GGAAAGATCTTAGTTGTATCTGG + Intergenic
1110154351 13:72295569-72295591 AGAAAGATGTTTGCTGAGAAGGG + Intergenic
1110467228 13:75815660-75815682 GGAAAGATGTTTGTTGAAACTGG + Intronic
1110608668 13:77463829-77463851 GGTACGATTTTTGTAGAAACAGG - Intergenic
1110934321 13:81266143-81266165 GGTAAGATGATTGATGAAAGTGG - Intergenic
1112611602 13:100960366-100960388 GTAGAGATGATTTTTGAAACAGG - Intergenic
1113570943 13:111357188-111357210 GGAAAGATGTTCCTTGATACAGG + Intergenic
1114372695 14:22108001-22108023 GAAAAGAAGTTTGGTGAAACAGG + Intergenic
1115863908 14:37721543-37721565 GGCAAGATTTTTCTTGAAAAGGG - Intronic
1116170103 14:41389948-41389970 GTGATGATGTTTGTTCAAACTGG + Intergenic
1116216017 14:42018081-42018103 GGAGAAAAGTTTGTTGAAATTGG + Intergenic
1116396081 14:44449933-44449955 GGAAAGTTGTTTACTGAAACTGG + Intergenic
1116475794 14:45337741-45337763 GGAAGGATGCTTTGTGAAACTGG + Intergenic
1116996004 14:51325591-51325613 GTAAAGATGTTTATGGAAAAAGG - Intergenic
1120074523 14:80140423-80140445 AGGAAGATATTTGTTGATACAGG - Intergenic
1120496369 14:85242079-85242101 GAAAAGATCTTCTTTGAAACTGG + Intergenic
1125068732 15:35525832-35525854 GGAAAAATGTTTTTTGAGATAGG - Intronic
1126257727 15:46647696-46647718 TGACAGTTGTTTGTAGAAACAGG - Intergenic
1126959987 15:53981235-53981257 AGAAACATATATGTTGAAACTGG - Intergenic
1128435847 15:67647448-67647470 TCAAACATTTTTGTTGAAACAGG + Intronic
1128917852 15:71581602-71581624 GGAAAAAAGTTTTTTGACACTGG - Intronic
1129770562 15:78200924-78200946 GGAAAGGTGTATGTTGAGGCTGG - Intronic
1132040998 15:98524577-98524599 GGAAAGATGTTTGTCAGATCTGG + Intergenic
1135106473 16:19654100-19654122 GGAAAGATCATTGTAGAAAGAGG - Intronic
1135886047 16:26308992-26309014 GGAATGATGTTTGTGAGAACAGG + Intergenic
1136926414 16:34379108-34379130 GGAAAGATGTATGAAGAAAAAGG + Intergenic
1136978160 16:35032699-35032721 GGAAAGATGTATGAAGAAAAAGG - Intergenic
1137026051 16:35475997-35476019 AAAAAAATGTTTTTTGAAACAGG - Intergenic
1137331840 16:47505340-47505362 GAAAAGGTGTTGGTTGATACAGG + Intronic
1137740655 16:50769421-50769443 GGAAAGATGTTTGATATCACTGG - Intronic
1137993149 16:53180351-53180373 GGGAAAATGTTGGTTAAAACTGG + Intronic
1138590366 16:57996268-57996290 GGAAAGAGGTTTGTGGAATCAGG + Exonic
1138929217 16:61631944-61631966 TGAAAGAGGTTTGTTGTAAGAGG - Intergenic
1141288644 16:82696835-82696857 GTCAAGATGTTGGTTGAAATAGG + Intronic
1142904321 17:3032389-3032411 GTATGGATTTTTGTTGAAACAGG + Exonic
1145113281 17:20184625-20184647 GGTAAAATATTTGTAGAAACAGG + Intronic
1146230323 17:31102178-31102200 GCAAACATGTTTTTTGAATCAGG + Intronic
1148713609 17:49699826-49699848 GGGAAGATGTCTCTTAAAACAGG + Intergenic
1149051947 17:52315602-52315624 AGAAAGAAGTTTGTTTAAACAGG - Intergenic
1152047368 17:77946247-77946269 GGAAATATCTTGGTTGAGACTGG + Intergenic
1152351799 17:79788049-79788071 GAAAGGATCTCTGTTGAAACAGG + Intergenic
1152516211 17:80826329-80826351 GGAAACATGTTTCTTGCAAATGG - Intronic
1153754951 18:8272844-8272866 TGAAAGAAGTGTGTTGAAAGAGG + Intronic
1155019841 18:21886158-21886180 ATAAAGATGTTCTTTGAAACCGG - Intergenic
1156940111 18:42757052-42757074 GGAAAGGTGTTTATTGAACATGG - Intronic
1160181192 18:76638186-76638208 GGTAAGGAGTTTGCTGAAACAGG - Intergenic
1163295793 19:16411868-16411890 GCAAATATTTTTGTAGAAACAGG + Intronic
1163983467 19:20923434-20923456 GGAAAGGGGTTGGTTGAAACCGG + Intronic
1166148404 19:40852636-40852658 GGAAAGTTGTTTGTTGATTTTGG + Intronic
1166152546 19:40884421-40884443 GGAAAGTTGTTTGTTGATTTTGG + Intronic
1166177639 19:41086224-41086246 GGAAAGTTGTTTGTTGATTTTGG - Intergenic
1168289537 19:55350815-55350837 GGAAAGAAGTTTAGTGAAACAGG + Intronic
925510474 2:4620204-4620226 GAAAAGGTGTGTGTTAAAACAGG - Intergenic
925943867 2:8842966-8842988 GGAAAGAAGTTATTGGAAACAGG + Intergenic
926947084 2:18200075-18200097 GGAAAGATTTCTGTTGATGCTGG + Intronic
928195682 2:29215088-29215110 AGAAAGGTGTTTGTTTAAGCTGG + Intronic
930766087 2:55086736-55086758 GGAAAGATGATGGCTGAAAGGGG - Intronic
932341550 2:70965477-70965499 GAAAAGATAATTGTTGAAGCTGG + Intronic
935298878 2:101675463-101675485 GGAGAGATGCATGTGGAAACTGG - Intergenic
935484102 2:103631516-103631538 GGAAATCTGTTTGTTTATACTGG + Intergenic
937687475 2:124713887-124713909 GGAAAGATGTTTGCTGAACTAGG - Intronic
937874314 2:126809745-126809767 GGAAAAATGTTTGTTGTTAAAGG - Intergenic
938900025 2:135791829-135791851 GGAAAGATGCTTGATGGAAAAGG + Intronic
940338388 2:152553067-152553089 GGAAGGAGGTTTGTAGAAAAGGG + Intronic
943314089 2:186364340-186364362 GGAAAGAAGTCTGTTGAAGAAGG - Intergenic
943890579 2:193281694-193281716 AGAAAGATTTTTTTTGAAAGGGG - Intergenic
944516603 2:200518405-200518427 GGAATGAAGTTTCTTGAAAAAGG + Intronic
944786933 2:203081113-203081135 GGAAAGTTGTTTGTTGAATATGG + Intronic
944969332 2:204974154-204974176 GTAAAGATGTTTGAAGAATCTGG - Intronic
947147320 2:227080274-227080296 GGAAAGATGATTGTTTTAAGAGG - Intronic
1170935948 20:20809661-20809683 GGAAAGGTATTTCTTGAAGCTGG + Intergenic
1172534512 20:35663003-35663025 GGACAGATTTTTAATGAAACAGG - Intronic
1172650921 20:36500779-36500801 GGAAAGAGGTTTGGTTAAATAGG - Intronic
1173099757 20:40074848-40074870 AGAAAGCTATTTGTTGGAACTGG + Intergenic
1173271568 20:41540981-41541003 TGAAAGATTTTTTTTAAAACAGG + Intronic
1174859996 20:54082217-54082239 GGAAGTATGTTTGTTCAAAGTGG - Intergenic
1178780194 21:35595517-35595539 GAAAAAATTTTGGTTGAAACTGG - Intronic
1179956542 21:44743065-44743087 GGAAAGACAATTTTTGAAACAGG - Intergenic
1181929326 22:26387236-26387258 AGAAACATGTTATTTGAAACTGG - Intergenic
1182170208 22:28221095-28221117 GGAAAGTTGTTAGTTGGAGCAGG + Intronic
1184057657 22:42063153-42063175 GGAATGGTGTTTGCTGAACCAGG - Intronic
949152315 3:784451-784473 ATAAAGATGTTCATTGAAACAGG - Intergenic
949244998 3:1916702-1916724 ATAAAGATGTTCTTTGAAACCGG - Intergenic
949427876 3:3939075-3939097 ATAAAGATGTTTTTTGAAACCGG - Intronic
950079066 3:10208305-10208327 GGAAGGATTTTTTTTGAGACAGG + Intronic
951701301 3:25499488-25499510 GCAAAGCTGTATGTAGAAACGGG + Intronic
953482159 3:43261084-43261106 TGAAAGTGGGTTGTTGAAACAGG - Intergenic
955007427 3:54982528-54982550 AGAAAGATGTTACTGGAAACGGG + Intronic
955559901 3:60177587-60177609 AGAAAGGTGTTTATTGAAAGTGG + Intronic
955885035 3:63589023-63589045 GGAAAAATGCATGTTGATACTGG - Intronic
955993160 3:64650258-64650280 GGAGAGGTGTTTGCTGAAAACGG - Intronic
955999622 3:64715222-64715244 AGAGAGTTGTTTGTTGAATCGGG + Intergenic
957186618 3:76949725-76949747 CCCAAGATGTTTGTTAAAACAGG + Intronic
957337313 3:78848141-78848163 GGAAATATGTTAGTTCAAACTGG + Intronic
959391359 3:105778598-105778620 GGAAAGCTTTTTGATGAAAGGGG + Intronic
959668354 3:108946134-108946156 GGTAATTTGTTTTTTGAAACAGG + Intronic
963632968 3:147756647-147756669 GGAAGCATGTGTGTTGAAAGAGG + Intergenic
963940655 3:151093028-151093050 TGAAAGATGCTTGTTAAAAATGG + Intronic
964387826 3:156167652-156167674 GTTAAAAAGTTTGTTGAAACTGG - Intronic
965066245 3:163854206-163854228 GTAAAGAGATTTATTGAAACAGG + Intergenic
965971503 3:174561630-174561652 GCAAAGTTGTTTGCTGCAACTGG + Intronic
970430996 4:15988978-15989000 GGAGAGAAGTGTGTGGAAACTGG - Intronic
971464884 4:26946835-26946857 GCAAAGATGGTTTTTGACACAGG - Intronic
972845217 4:42980853-42980875 TGAAAGATTTTTGATGAAAATGG - Intronic
974486762 4:62515184-62515206 GGAAATGTGTTTGTTGTAAGAGG + Intergenic
974981496 4:68963280-68963302 GGAAAGCTGTGTCTTGAGACTGG - Intergenic
975202169 4:71604400-71604422 GGAAAGGGGATTGTTGAAAGTGG + Intergenic
978515435 4:109563752-109563774 AGAAAGATATTTGTTGAATGAGG + Intronic
979643146 4:123033457-123033479 GGAAAGATGTTTCTGGGAACTGG + Intronic
980249164 4:130291657-130291679 GAAAACATGTATGTTAAAACAGG + Intergenic
980593752 4:134926224-134926246 ATAAAGATGTTCTTTGAAACCGG - Intergenic
980996468 4:139784327-139784349 GGCAAGATGGTTTTAGAAACAGG - Intronic
981085129 4:140675858-140675880 GGAAACATGTTTATTGTACCTGG - Intronic
981595423 4:146415972-146415994 GGAAAGCAGTTTGTTGGAATTGG - Intronic
983434355 4:167693552-167693574 TAAAACATGTTTGTTGAAAAGGG - Intergenic
983908682 4:173211423-173211445 GGAAAGCTGTTTGATCACACAGG - Intronic
984536206 4:180978856-180978878 GTAAAGTTCTTGGTTGAAACGGG + Intergenic
984654836 4:182306356-182306378 TGAAAGATGTTTTCTGAATCAGG + Intronic
988105761 5:26744271-26744293 GCAAAAATATTGGTTGAAACTGG + Intergenic
988643468 5:33067702-33067724 GGAAAGATATATGGGGAAACAGG + Intergenic
990298029 5:54422827-54422849 GGAAAGATGTTCATTTAATCAGG + Intergenic
991103185 5:62816071-62816093 GGAGAAATGTTTATTGAAACAGG + Intergenic
991980733 5:72227919-72227941 AGAAAGATCTTTGTTAATACTGG + Intronic
992599436 5:78383510-78383532 GGAAAAATCTTTCTTGACACTGG - Intronic
992762961 5:79967844-79967866 AGAAAGATCTTTGTTGAACAAGG + Intergenic
994033753 5:95175423-95175445 GTACCAATGTTTGTTGAAACAGG - Intronic
994365478 5:98911900-98911922 GGAAAGATGATTGACCAAACTGG + Intronic
995249580 5:109975935-109975957 GGAAAAATGTTCCTTGATACTGG - Intergenic
996456610 5:123691330-123691352 GCAAGCATGTTTGTGGAAACTGG - Intergenic
996489757 5:124079723-124079745 AGAAAGAAGGTTGATGAAACTGG + Intergenic
996582326 5:125045261-125045283 GGATGAATGGTTGTTGAAACTGG - Intergenic
998142510 5:139708238-139708260 TGATAGAAGTTTGCTGAAACAGG - Intergenic
1000650750 5:163815473-163815495 TGAAAAATGTTTGTTTAAAAAGG + Intergenic
1000729912 5:164821232-164821254 GTACAAATGATTGTTGAAACTGG - Intergenic
1002283632 5:178148042-178148064 GGAAGGAATTTTGTTGAAAGGGG + Exonic
1003721137 6:8703506-8703528 AGTAACATGTTTGTTGTAACTGG - Intergenic
1003784558 6:9470236-9470258 GGTAAGATGTTTATTTAAAAAGG - Intergenic
1005026037 6:21464051-21464073 GGATAGATGTTCTTTGAAAGTGG - Intergenic
1009904513 6:69853083-69853105 GGAGAGAAGATTGGTGAAACTGG - Intergenic
1010033971 6:71300413-71300435 GGAAAGATGTTAGTGTAATCTGG + Intronic
1010826293 6:80480391-80480413 GGAAAGATTTCTGCTGAAAGTGG - Intergenic
1014453469 6:121610023-121610045 GGATAGATATTTGTTGAATGTGG + Intergenic
1014698348 6:124652224-124652246 GGAAACATCTTTTTGGAAACTGG - Intronic
1014916092 6:127150447-127150469 GCAGAAATTTTTGTTGAAACAGG - Exonic
1016347189 6:143126510-143126532 AGAAAGATGTCTGTGGAAAGCGG + Intronic
1016564084 6:145432819-145432841 GGTAAGATGTTTGATGAACATGG - Intergenic
1017610271 6:156178106-156178128 GGAAAGATGTTACTGGAAAGGGG - Intergenic
1018409335 6:163526201-163526223 TGAAAGATGATTATTGAAACTGG + Intronic
1018506762 6:164479445-164479467 ACAAAGATGTTTATTGAAACAGG + Intergenic
1020647804 7:10836611-10836633 GGAAAAATATTTGCTGACACAGG - Intergenic
1021402474 7:20225564-20225586 GGAAGGATGTGTGTTGATTCAGG - Intergenic
1022018957 7:26380065-26380087 GGAAGGATGTCTGGTGAATCAGG + Intergenic
1023796086 7:43793592-43793614 TAAAAGATTTTTGTAGAAACAGG - Intronic
1026316414 7:69231552-69231574 GGAGAGATGTTTGCTGTAAATGG + Intergenic
1026444939 7:70475862-70475884 GGAAAGTTTTTTGTAGAGACAGG - Intronic
1027591473 7:80124588-80124610 GGAACTATTTTTGTTGAAAGGGG + Intergenic
1028607472 7:92670838-92670860 AGAAAGATTTTTGTTAAAAGGGG - Intronic
1029885431 7:103865038-103865060 GGAGAATTGTTTGTTGAACCTGG + Intronic
1031748640 7:125540126-125540148 GGCAAGATAATTGTTGAACCTGG + Intergenic
1031757165 7:125659771-125659793 GGAAAGAAGAATGTTGAACCAGG + Intergenic
1035495315 7:159320303-159320325 GGAAAGTGGTTTGTTCAAATAGG - Intergenic
1036156841 8:6350037-6350059 TGAATGATGCTTGTTGAGACTGG + Intergenic
1036918099 8:12824500-12824522 GAAAAGAGGTTACTTGAAACAGG + Intergenic
1039195345 8:35024845-35024867 GGTCAGATGATTGCTGAAACAGG - Intergenic
1040888987 8:52295773-52295795 AGAAAATAGTTTGTTGAAACTGG + Intronic
1040897180 8:52380957-52380979 GGAGAGATGATTGTTGAGAGGGG - Intronic
1041770012 8:61463020-61463042 GGAAAGATCATTGATGAAGCTGG - Intronic
1043147900 8:76679314-76679336 GGGAAGAAATTTGTTGAAAGTGG - Intergenic
1043934144 8:86124010-86124032 AGAAATTTGATTGTTGAAACTGG - Intronic
1044721609 8:95155066-95155088 GAAAAGATGTTTGTTTTAACAGG + Exonic
1044954580 8:97466529-97466551 ACAAAGATTTTTGTTGAAAGGGG - Intergenic
1045119866 8:99025264-99025286 GGAAAAAAATTTTTTGAAACAGG - Intronic
1047471079 8:125173068-125173090 GTAAAGAAGATTGTTGCAACAGG - Intronic
1047963386 8:130027333-130027355 GCAAAGCTGTTTGTTGAATGTGG - Intergenic
1054964721 9:71010143-71010165 GGAAAAATGTTTCATGAAATTGG + Intronic
1055199355 9:73640358-73640380 TGAAAGATGTTGGATGAAAATGG + Intergenic
1055220988 9:73931525-73931547 GAAAAGATGTTTGTTGACAGAGG - Intergenic
1055227009 9:74010589-74010611 TGAAAGATGGTTGTTTGAACAGG - Intergenic
1057018934 9:91680977-91680999 GGAAAAATATTAGTCGAAACGGG - Intronic
1057318223 9:93986310-93986332 GGAAAGTTGTTTACTGAAACTGG - Intergenic
1058133295 9:101277791-101277813 GCAAGAATGTGTGTTGAAACAGG - Intronic
1058298112 9:103334557-103334579 AGAAAGAGGTTTGCTGAAAGAGG - Intergenic
1059445714 9:114336696-114336718 GGACAGATATTTTTTTAAACTGG - Exonic
1060523031 9:124304780-124304802 GAAAAAATATTTGCTGAAACCGG + Intronic
1061041952 9:128145495-128145517 GGAAAACTGTTTCTGGAAACAGG + Intergenic
1187682023 X:21777527-21777549 GGAAAGATGTTTTTAAAAGCCGG + Intergenic
1187764285 X:22622551-22622573 GGAAAGATGTATGCTGTAACAGG + Intergenic
1188471800 X:30549019-30549041 GTAAAAATATTTGTTGAAAACGG + Intergenic
1190588565 X:51973601-51973623 GGGAAGGTATTTGTTGAAAATGG - Intergenic
1194769556 X:97884759-97884781 GGAAATATGTTTGTTAAAGACGG + Intergenic
1196414901 X:115460573-115460595 GGAAAGATGTGTTTTCAAAAGGG - Intergenic
1197344212 X:125312726-125312748 GGTAAGATCATTGATGAAACTGG + Intergenic
1200849400 Y:7867192-7867214 TGAAAGAAGTTTGCTGACACAGG + Intergenic
1201325759 Y:12756014-12756036 GGAGTGATGTTTTTTGCAACGGG + Intronic