ID: 1110468908

View in Genome Browser
Species Human (GRCh38)
Location 13:75835338-75835360
Sequence CTGTGAGTATTTGGAGAAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 436}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110468905_1110468908 -5 Left 1110468905 13:75835320-75835342 CCGAAAGCCTTCAGAGTTCTGTG 0: 1
1: 0
2: 2
3: 25
4: 225
Right 1110468908 13:75835338-75835360 CTGTGAGTATTTGGAGAAGTAGG 0: 1
1: 0
2: 1
3: 35
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110468908 Original CRISPR CTGTGAGTATTTGGAGAAGT AGG Exonic
901568114 1:10135829-10135851 ATGTAAGTTTTTGAAGAAGTAGG + Intronic
903274893 1:22214981-22215003 TAGTGAGTATATGGGGAAGTAGG + Intergenic
903366214 1:22806908-22806930 CTGTGTGTCTCTGGGGAAGTAGG - Intronic
903505425 1:23831446-23831468 CTGTGACAATTAGGAGTAGTAGG - Intronic
905346055 1:37311839-37311861 CTGTGAGAACTTGGAGTAGAGGG - Intergenic
906746927 1:48228593-48228615 CAGTGAGTAAATGGTGAAGTGGG - Intronic
907209695 1:52809651-52809673 CGGTGAGAATGTGGAGAAATCGG - Intronic
907234560 1:53033677-53033699 TTGTGAGGATGTGGAGAAATTGG + Intronic
907338632 1:53717562-53717584 GTGTGTGTATTGGGTGAAGTGGG - Intronic
908479918 1:64529032-64529054 CTGTTATAATTTGGAGAAATGGG + Intronic
908760317 1:67505557-67505579 CTGGGAGTTTTTGGGTAAGTTGG + Intergenic
909082566 1:71130211-71130233 GTCTGAATATTTGAAGAAGTAGG - Intergenic
909224743 1:73005247-73005269 CTGTGACCATTTGGCAAAGTTGG + Intergenic
909309046 1:74122216-74122238 CTGAGAGGATGTGGAGAAATAGG - Intronic
910589791 1:88918527-88918549 CAGTGAGTAGTGGGAGCAGTGGG + Intergenic
910974189 1:92888666-92888688 TGGTGAGGATGTGGAGAAGTAGG - Intronic
911886943 1:103313847-103313869 CTGTGTGTCTTTGGGTAAGTTGG - Intergenic
912107968 1:106304561-106304583 CTGGAAGAATTTGGAGGAGTAGG - Intergenic
913174090 1:116257942-116257964 CAGTGAGGATGTGGAGAAATTGG + Intergenic
914970569 1:152305298-152305320 CTGTGAGTGTCTAGAGATGTCGG + Exonic
914970721 1:152306270-152306292 CTGTGAGTGTCTAGAGATGTCGG + Exonic
914971665 1:152312105-152312127 CTGTGAGTGTCTAGAGATGTCGG + Exonic
915346537 1:155200393-155200415 CTGTGAGAATTTGGATCAGGTGG - Intronic
915457524 1:156050819-156050841 CTGTGAGTCTGGGGAAAAGTTGG - Intronic
916380074 1:164199970-164199992 CTGAGAGGATGTGGAGAAATAGG + Intergenic
916881426 1:169022919-169022941 CTGTAAGAATTTGGAGAAGGGGG - Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
920782318 1:209006000-209006022 CTGTGAATATTTGAAGGAGGAGG - Intergenic
921804007 1:219433582-219433604 CTGAGTCTGTTTGGAGAAGTTGG - Intergenic
922628618 1:227080836-227080858 TTGTGAGTATGTGGCCAAGTTGG - Intronic
924847635 1:247789353-247789375 CTGTGAGGGTTTGGCAAAGTAGG - Intergenic
1062853522 10:765345-765367 TGGTGAGTATATGGAGAAGGGGG + Intergenic
1062955437 10:1537320-1537342 CAGTGAGGATGTGGAGAAATTGG + Intronic
1063743969 10:8858339-8858361 CGGTGAGTAGTTGGAGGAGATGG + Intergenic
1065649067 10:27868186-27868208 TTGTGAGTCTGTGGAGAAATAGG + Intronic
1066264186 10:33759422-33759444 CTGTGAATATGTGGAAAAATAGG - Intergenic
1067265341 10:44737039-44737061 TGGTGAGTATTTGGAGAAAAGGG - Intergenic
1068205456 10:53845233-53845255 CTGTAAGGATATGGAGAAGGAGG + Intronic
1069414351 10:68184836-68184858 CTGGGAGTATGCTGAGAAGTGGG + Intronic
1070189096 10:74094985-74095007 TTGTGAGGAGTTGGAGAATTGGG + Intronic
1070829502 10:79409840-79409862 CTGCGAGTGTTTGGAGGAGCAGG + Intronic
1071130087 10:82380446-82380468 CAGTGAGTATTTTAAGAAGAAGG + Intronic
1071190573 10:83094687-83094709 TTGAGAGGATTTGGAGAAATAGG + Intergenic
1072298922 10:94040279-94040301 TTGGGAGAATCTGGAGAAGTTGG - Intronic
1072549792 10:96468788-96468810 TTGTCAGGATTTGGAGAAGCTGG - Intronic
1072606502 10:96988040-96988062 CTCTGAGTTTCTGGAGAAGCTGG + Intergenic
1073600110 10:104838396-104838418 CTGTGAGTGGTGGGAGAGGTCGG + Intronic
1073638132 10:105220361-105220383 GTGTGAGTTTATGGAGAAGGGGG + Intronic
1075187269 10:120274361-120274383 TGGTTAGTATTTGGAGAATTTGG - Intergenic
1076183714 10:128430721-128430743 CTCTTAGTGTCTGGAGAAGTGGG + Intergenic
1076201724 10:128564292-128564314 CTGTCTGTATTTGGAGACATAGG + Intergenic
1077031227 11:468866-468888 CTCTGAATAATTGGAGAAGGAGG + Intronic
1077867884 11:6238254-6238276 CTGTGAGCTTCTGGAGAAGGGGG + Intronic
1078189632 11:9081966-9081988 CTGTGAGGATGTGGAAAAATTGG - Intronic
1078471966 11:11595542-11595564 TGGTGAGGATGTGGAGAAGTTGG - Intronic
1078730696 11:13971370-13971392 CTCTGAGTATCTGGAGAAGTAGG + Intronic
1078779950 11:14428339-14428361 TTGTGAGAATGTGGAGAAATTGG + Intergenic
1080827593 11:35861178-35861200 CTGGGAGCAGTTGGAGAAGAAGG - Intergenic
1081118642 11:39236269-39236291 CTGAGAGGATGTGGAGAAATAGG + Intergenic
1081306973 11:41524495-41524517 CTGTGTGTGTTTTGAGGAGTGGG + Intergenic
1083532983 11:63441843-63441865 CAGAGAGGATTTGGAGAAATAGG + Intergenic
1083963984 11:66031501-66031523 CTGTGACTATTTTGAGAAGCTGG + Intergenic
1085142599 11:74161215-74161237 CTAAGAGGATTTGGATAAGTGGG + Intronic
1087022257 11:93615392-93615414 CTGTGAGTGTTTGAGGGAGTGGG - Intergenic
1087492659 11:98847895-98847917 CTCTGATTATTTGGAGTAGGTGG - Intergenic
1087617725 11:100507411-100507433 GTGTGTGTATGTGGAGAAGGGGG - Intergenic
1088656040 11:112000833-112000855 TGGTGAGAATGTGGAGAAGTTGG + Intronic
1088965135 11:114712624-114712646 TTGTGAGGATGTGAAGAAGTTGG + Intergenic
1089496806 11:118912143-118912165 CTGTGAGTGTGTGGAGGAGGAGG - Intronic
1090154826 11:124426069-124426091 CTGTGAAGATTTGGAGATGGTGG - Intergenic
1090631399 11:128652288-128652310 TAGTGGGTATTTGGAGAACTGGG - Intergenic
1091242733 11:134064769-134064791 CTTTGAGGATGTGGAGAAGCAGG - Intergenic
1091964551 12:4727001-4727023 CTGTAAATATTTGGATCAGTTGG - Intronic
1092494684 12:8980817-8980839 CTGTGGGTATTTGTGGCAGTGGG + Intronic
1092794503 12:12096738-12096760 CGGTGAGGATGTGGAGAAATTGG + Intronic
1093037865 12:14350476-14350498 CTGTAAGAATTTGGAGAAGCAGG + Intergenic
1093649463 12:21626619-21626641 CTGTGAGCCTTTGGAGGAGAAGG + Intergenic
1095353998 12:41249503-41249525 TTGTGAGGATTTGGGGAAGAAGG + Intronic
1096128470 12:49137627-49137649 CTTTGAGTCTTTGGTGTAGTGGG + Intergenic
1096148759 12:49295933-49295955 CTCTGAGTGTTTGGGGAGGTGGG + Intronic
1096687616 12:53299342-53299364 CTGAGAGTTTTTGCAGAAATGGG + Exonic
1096742491 12:53704068-53704090 CTCTGCATATTTGGAGAAGTAGG - Intergenic
1096934382 12:55255301-55255323 TGGTGAGGATGTGGAGAAGTAGG + Intergenic
1097260277 12:57715969-57715991 CGGTGAGTAATTAGAGAAGGAGG + Exonic
1098325350 12:69296618-69296640 CGGAGAGGATATGGAGAAGTTGG + Intergenic
1098377004 12:69826732-69826754 CTGTGAATAGTTGGAAAAGGTGG + Intronic
1098414073 12:70214151-70214173 GTTTGTCTATTTGGAGAAGTAGG + Intergenic
1099411509 12:82334675-82334697 CTGTGTGTGTATGGGGAAGTGGG - Intronic
1099817063 12:87663048-87663070 GTTTTTGTATTTGGAGAAGTAGG - Intergenic
1099997424 12:89794400-89794422 ATGTTAATATTTGGAGAATTTGG - Intergenic
1100520563 12:95371332-95371354 TTGTGAGGGTTTGGAGAAATTGG - Intergenic
1101504973 12:105337679-105337701 ATAGGAGTATTTGGGGAAGTTGG + Intronic
1102398556 12:112609085-112609107 CTGTGAGGATTTGGGGAAGATGG - Intronic
1102719677 12:115005348-115005370 CTGGAAGTATTTGGAAAAGGAGG - Intergenic
1104259960 12:127173240-127173262 CTGTGTATATTTGGAGGAGGTGG + Intergenic
1104472193 12:129038189-129038211 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1104497263 12:129252549-129252571 CTGAGAGGATGTGGAGAAATAGG + Intronic
1104675749 12:130710852-130710874 CTGTGAGGATTGGGAGCAGTGGG - Intronic
1104952825 12:132450106-132450128 CTGAAAGTATTGGGAGAAGGTGG - Intergenic
1106373167 13:29157343-29157365 TGGTGAGTATGTGGAGAATTGGG - Intronic
1106738115 13:32608757-32608779 CCAGGATTATTTGGAGAAGTTGG + Intronic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1107150117 13:37101387-37101409 TTGTGAGTATTAGCAGAAGTAGG + Intergenic
1107172659 13:37361356-37361378 CTTTGAGAATTTGGAGTAGAGGG + Intergenic
1107386224 13:39912894-39912916 AGGTCATTATTTGGAGAAGTAGG - Intergenic
1107393101 13:39987743-39987765 CTGTGAGTATTTGAAGATATTGG + Intergenic
1108468619 13:50744924-50744946 TGGAGAGTATGTGGAGAAGTTGG + Intronic
1108544889 13:51482870-51482892 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1108549725 13:51531866-51531888 CTGAGAGGATGTGGAGAAATAGG + Intergenic
1108680313 13:52774446-52774468 CTGTGTGTATATGAAGAAGTGGG + Intergenic
1109873301 13:68365392-68365414 TTTTGAGTATTTGGGGAAGGGGG - Intergenic
1110416988 13:75263806-75263828 CTGTGACTATTTGTAGCAGCTGG - Intergenic
1110468908 13:75835338-75835360 CTGTGAGTATTTGGAGAAGTAGG + Exonic
1111686781 13:91512250-91512272 CTGGTAGTATTTGGAGAACTTGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112602243 13:100868398-100868420 CTGTGGGTATTTGGAGGATAGGG + Intergenic
1112839631 13:103560422-103560444 TTGAGAGGATTTGGAGAAATAGG + Intergenic
1113300863 13:109018019-109018041 CTGTGATCCTTTGGAGAAGAAGG + Intronic
1113374082 13:109747796-109747818 GTTTGAGAATCTGGAGAAGTGGG + Intergenic
1116041833 14:39695174-39695196 GGGTGAGTATTTTGAGAATTGGG - Intergenic
1116052379 14:39820665-39820687 TTGAGAGTATGTGGAGAAATAGG - Intergenic
1116351357 14:43867809-43867831 CTGTGAGGACTTGGAGAAGAGGG + Intergenic
1117825695 14:59701177-59701199 GTGTGAGGATGTGGAGAAATTGG + Intronic
1117950232 14:61075485-61075507 CTTTGAGAATTAGGAAAAGTTGG - Intronic
1118676952 14:68196459-68196481 GTGTGAAGATGTGGAGAAGTAGG - Intronic
1120164974 14:81187959-81187981 TGGTGAGGATTTGGAGAAATTGG - Intronic
1120619441 14:86745660-86745682 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1121057104 14:90865678-90865700 ATGTCAGTGTTTGGAGCAGTGGG + Exonic
1123770272 15:23521751-23521773 CTGAAAGAATTTGGAGAAATAGG - Intergenic
1124001430 15:25763580-25763602 CTGTCATTATTTGGAAAAGCTGG + Intronic
1124103436 15:26716554-26716576 CTGTGAGAAGTTGGTGAAGACGG - Intronic
1124713567 15:32034984-32035006 CTGTGGGAATGTGGAGAAGGGGG + Intronic
1125766805 15:42141774-42141796 TTGTGTGTTTTTGGAGAAGATGG - Exonic
1126390987 15:48151885-48151907 ATGGGAGGATTTGGAGGAGTTGG - Exonic
1127848814 15:62895552-62895574 CAGAGAGTATTTGGAGCAGAGGG + Intergenic
1127860475 15:62989671-62989693 GAGGGAGTATTTGTAGAAGTTGG - Intergenic
1130513009 15:84604580-84604602 CTGTGTTTATTTGGAGTGGTTGG + Intronic
1131237959 15:90713426-90713448 CTGCAAGTTGTTGGAGAAGTTGG - Intergenic
1131731170 15:95282974-95282996 ATGTGGGCATTTGGAGGAGTGGG - Intergenic
1131808397 15:96147381-96147403 CTGTGAGTATCTTAAGAATTGGG - Intergenic
1131878774 15:96839702-96839724 CAGTGAGGATGTGGAGAAATTGG + Intergenic
1133346730 16:5076043-5076065 CTGTTGGTAGCTGGAGAAGTGGG + Intronic
1136031808 16:27508548-27508570 CTTTGAATCTTTGAAGAAGTCGG + Exonic
1137841495 16:51644793-51644815 CTGTGCATATTTCTAGAAGTGGG + Intergenic
1138113009 16:54339587-54339609 TTGTGAGGATATGGAGAAATTGG - Intergenic
1139163483 16:64538858-64538880 CTGGAAGAATTTGGAGCAGTAGG + Intergenic
1140169278 16:72586290-72586312 CTGAGAGGATGTGGAGAAATAGG + Intergenic
1140265390 16:73416285-73416307 CTGTAAATATTTTCAGAAGTGGG - Intergenic
1141532605 16:84657212-84657234 CTGTGAGTACCTGGAGCAGGAGG + Exonic
1143054031 17:4149306-4149328 CAGTGAGGAGCTGGAGAAGTAGG + Intronic
1143092923 17:4459926-4459948 GTGTGAGTATTGGGAGGAGAGGG + Intronic
1143450416 17:7033260-7033282 CTGGAAGCATTTGGAGGAGTAGG - Intergenic
1144749170 17:17636389-17636411 CTGGAAGAATTTGGAGAAGCAGG + Intergenic
1145065915 17:19761275-19761297 TTGTGAGGATGTGGAGAAATTGG - Intergenic
1145960865 17:28885892-28885914 CTGTGAGAATATTGAGACGTCGG - Intronic
1147214069 17:38889054-38889076 CTGTGAGAATTCGGTGAACTAGG + Intronic
1147435455 17:40410371-40410393 CTGAGATGAGTTGGAGAAGTAGG + Intronic
1148756823 17:49977564-49977586 CTGTGTGTATTTGGTGAGGAGGG - Intergenic
1149363831 17:55920853-55920875 CTGTGAGGTATTGGGGAAGTAGG - Intergenic
1150539358 17:66080520-66080542 CTGGGAGGATGTGGAGAAATAGG + Intronic
1150544184 17:66136367-66136389 CTGTGAGTACTTGCAGAATCCGG - Intronic
1150712447 17:67543449-67543471 CAGTGATTATGTGGAGAAATTGG - Intronic
1151343220 17:73485187-73485209 GTGTGTGTATGTGGAGAGGTGGG + Intronic
1153357869 18:4157812-4157834 CTGTGAGTAAGTGGGGAAGCTGG + Intronic
1153420716 18:4901734-4901756 CTTTCAGAATTGGGAGAAGTAGG - Intergenic
1154403375 18:14064582-14064604 AGGGGAGTATTTGGAAAAGTAGG + Intronic
1155221128 18:23687101-23687123 TTGTGAGGATGTGGAGAAGTTGG - Intergenic
1155406673 18:25496207-25496229 CTGGGAGAATGTGGAGAAGGAGG + Intergenic
1155536003 18:26818974-26818996 GTCTGTGTATTTGAAGAAGTAGG + Intergenic
1156092051 18:33483097-33483119 GTGTGTGTATGTGGAAAAGTTGG - Intergenic
1156099846 18:33579365-33579387 GTGTGTGTGTTTGGTGAAGTTGG + Intronic
1156490479 18:37493041-37493063 CAGGGAGTACTTGGAGGAGTGGG - Intronic
1156653258 18:39252350-39252372 CTGTGAGAGATTGGAGAAGGTGG - Intergenic
1157427603 18:47597337-47597359 CTATGAGAATCTGGAGAAGTGGG + Intergenic
1157522074 18:48352321-48352343 CTGTGAGCACTTGGATAAGCTGG - Intronic
1157560824 18:48644743-48644765 ATGTGAGTATGGGGAGGAGTAGG + Intronic
1157822472 18:50783494-50783516 TTGTGAGGACGTGGAGAAGTTGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158733050 18:60046922-60046944 CTGTGAGTAAGTGAAGAAGATGG + Intergenic
1158845341 18:61436389-61436411 TGGTGAGGATGTGGAGAAGTTGG - Intronic
1159880987 18:73858346-73858368 CAGTGGGTGTTTGGAGAAGGAGG - Intergenic
1159971100 18:74654564-74654586 ATGTGAGACTTTGGAAAAGTAGG + Intronic
1160227063 18:77019760-77019782 CTGCGAGGACTTGGGGAAGTTGG + Intronic
1161168607 19:2801997-2802019 ATGTGGGTATTGGGAGATGTGGG - Intronic
1161920844 19:7264620-7264642 CTATGATTTTTTGGAGGAGTGGG - Intronic
1162969871 19:14174214-14174236 CAGGGAGAATTTGGAGAGGTGGG + Intronic
1164013326 19:21228963-21228985 TTGTGATCATTTGGAGAAGAGGG - Intronic
1165313216 19:35040712-35040734 GTGTGAGTCTCTGGAGAGGTGGG + Intronic
1167257755 19:48441662-48441684 CAGTTAGGATTTGGAGCAGTTGG + Intronic
1167724982 19:51205247-51205269 CGGTGAGGATGTGGAGAAATTGG + Intergenic
1167790538 19:51676110-51676132 CGGTGAATATTTGGTGAGGTTGG + Intergenic
1167894922 19:52572908-52572930 CTGTGAGCATTTAGAGAAATAGG - Intronic
925584835 2:5454151-5454173 CTGTGGGCATTTGCACAAGTTGG + Intergenic
926630676 2:15133400-15133422 ATCTGAGTATTTGGAGGAGTTGG + Intergenic
927017838 2:18985155-18985177 CGGTGAGTATGTGGAGAAACTGG - Intergenic
927254235 2:21026183-21026205 CTGTGCGCACTTGGGGAAGTTGG - Intronic
928754295 2:34505686-34505708 CTGTGATCCTTTGGAGAAGAAGG - Intergenic
928951324 2:36815691-36815713 AGGTGAGTCTTTGGAGAAGCTGG - Intergenic
929459721 2:42094035-42094057 CTGCGGGTATCAGGAGAAGTGGG + Intergenic
929610248 2:43265678-43265700 CTGGGCGTGTTTGAAGAAGTGGG - Intronic
930363805 2:50413539-50413561 CTGTGAGGATGTGGAGAAAAGGG + Intronic
930576541 2:53157389-53157411 TGGTGAGGATTTGGAGAAATTGG - Intergenic
931080052 2:58758834-58758856 CTGTGAGTATTTTCTGATGTGGG + Intergenic
933751307 2:85603523-85603545 CTGTAAGTTTTTGGTGAAGCTGG - Intronic
934703211 2:96460216-96460238 CGGTGAGGATGTGGAGAAATAGG + Intergenic
934947862 2:98554858-98554880 CTATGTGTATTTGGGGACGTGGG + Intronic
935263713 2:101376668-101376690 CTGTGAGTCTTGTGAGAAGCTGG - Intronic
936058732 2:109280702-109280724 CAGTGAGTATCTGGAGACGTTGG + Intronic
936845344 2:116824384-116824406 CTGAGAGGATGTGGAGAAATAGG + Intergenic
936887813 2:117334180-117334202 TTCTGAATATTTGGAGAAGATGG + Intergenic
937299054 2:120827395-120827417 TGGTGAGGATGTGGAGAAGTTGG + Intronic
937634208 2:124137769-124137791 ATGTGAACATGTGGAGAAGTCGG + Intronic
937961371 2:127462566-127462588 GTGTGAGGATGTGGAGAAATGGG + Intronic
938096100 2:128465290-128465312 CTGGGACAATTTGGAGGAGTGGG - Intergenic
938611033 2:132948012-132948034 CTGTGAGGATGCTGAGAAGTTGG - Intronic
938898315 2:135775153-135775175 TTGTGAGGATGTGGAGAATTTGG + Intronic
939398804 2:141665437-141665459 TGGTGAGTCTGTGGAGAAGTTGG + Intronic
939505723 2:143044466-143044488 CTGAGAGGATGTGGAGAAATAGG - Exonic
939542347 2:143509609-143509631 CTGAGAATGTTTGGAGAACTGGG - Intronic
940139628 2:150479406-150479428 CTGTGAGGCTTTAGAGGAGTTGG + Intronic
940218939 2:151330904-151330926 TGGTGAGAATATGGAGAAGTTGG - Intergenic
940295110 2:152114516-152114538 CAGTGAGGATGTGGAGAAATTGG + Intergenic
941838841 2:170056547-170056569 CAGTGTTTATTTGTAGAAGTTGG + Intronic
942020633 2:171864669-171864691 TTGTTAGTAGTTGGATAAGTAGG - Intronic
942243533 2:173986287-173986309 CCTTGGGTATTTGGAGAAGTAGG + Intergenic
942250901 2:174047027-174047049 CTGGGGGTGTTTGGTGAAGTGGG + Intergenic
942725900 2:179007313-179007335 CTGTGTTTATTTGCATAAGTAGG - Intronic
943980552 2:194544344-194544366 CTGGGAGGATGTGGAGAAATAGG + Intergenic
944068048 2:195639859-195639881 CTGTAAGTATTAAGAGCAGTTGG - Intronic
945386379 2:209206855-209206877 TGGTGAGGATTTGGAGAAATAGG + Intergenic
945574108 2:211508484-211508506 CGGAGAGGATTTGGAGAAATAGG + Intronic
946157630 2:217817694-217817716 CATGGAGTACTTGGAGAAGTCGG + Exonic
947077377 2:226360053-226360075 CTGTGAGTATGTGAATATGTTGG + Intergenic
947702349 2:232244931-232244953 CAGTGAGGACTTGCAGAAGTAGG + Intronic
1168799033 20:632670-632692 CTGTGATCATTTGGTGAAGGTGG + Intergenic
1169422017 20:5468224-5468246 TTGTGAGGATATGGAGAAATTGG + Intergenic
1170881930 20:20304604-20304626 CTGTGAGGTTTTGGAGAGGCGGG - Intronic
1170881961 20:20304729-20304751 CAGTGAGGGTGTGGAGAAGTGGG + Intronic
1171140112 20:22733732-22733754 CTGTGAGCAATTGGAGAAGAAGG - Intergenic
1171856987 20:30355785-30355807 CTCTGAGTCTTTTGATAAGTTGG + Intergenic
1172054809 20:32146749-32146771 CGGTGAGGATGAGGAGAAGTTGG - Intronic
1172382511 20:34507216-34507238 ATGTGAGGATGTGGAGAAATTGG - Intronic
1173633508 20:44534297-44534319 CTGTTACTTTTTGGAGACGTGGG + Intronic
1173707981 20:45127155-45127177 CGGTGAGAATGTGGAGAATTTGG - Intergenic
1175302094 20:57950065-57950087 ATGTGAGAATGTGGAGAAATGGG + Intergenic
1176036214 20:63038351-63038373 CAGAGAGGATGTGGAGAAGTTGG - Intergenic
1177245340 21:18515782-18515804 CTGTTAGCATCTGGAGAAATAGG - Intergenic
1177681767 21:24380322-24380344 CCGTGAGGATGTGGAGAAATAGG - Intergenic
1178017108 21:28360063-28360085 TGGTGAGGATGTGGAGAAGTTGG - Intergenic
1179099535 21:38344681-38344703 CTGAGAGGATATGGAGAGGTTGG - Intergenic
1180977636 22:19857850-19857872 TGGTGAGGATGTGGAGAAGTTGG - Intergenic
1181755633 22:25022450-25022472 CAGTGAGCATTGGCAGAAGTAGG + Intronic
1183310190 22:37105388-37105410 CTGTGAACATTTGAGGAAGTGGG - Intronic
1184319020 22:43724817-43724839 CTGGAAGTATTTGGAGGAGCAGG - Intronic
949764092 3:7506420-7506442 CTGGAAGAATTTGGAGGAGTAGG - Intronic
949854354 3:8446938-8446960 TGGTGAGTATGTGGAGAAATTGG - Intergenic
950931179 3:16790477-16790499 CTGTAAGAATTTGGGGAAGCAGG - Intergenic
951129212 3:19022015-19022037 GTGTGTGTATTTGGAGAAGCAGG - Intergenic
951433330 3:22633633-22633655 CAGTGAGGATGTGGAGAAATTGG - Intergenic
951523885 3:23634830-23634852 TGGTGAGTATATGGAGAAATTGG - Intergenic
951792077 3:26497178-26497200 TGGAGAGTATGTGGAGAAGTAGG + Intergenic
951880389 3:27475657-27475679 CTGTTTGTATCTGGGGAAGTTGG - Intronic
952685773 3:36146754-36146776 CTGTGTCTATGTGGAGAAATTGG + Intergenic
953092786 3:39746395-39746417 CTGTAAGCCATTGGAGAAGTTGG - Intergenic
955069515 3:55560492-55560514 CTGAGAGTACATGGAGAAGAGGG + Intronic
955221287 3:57025531-57025553 GTGGGAGTATTTACAGAAGTAGG + Intronic
956042532 3:65159625-65159647 TTGTGAGGATGTGGAGAAATTGG - Intergenic
957545621 3:81632564-81632586 CTGGGAGGATGTGGAGAAATAGG + Intronic
958996345 3:100909776-100909798 CTGAGAGGATGTGGAGAAATAGG + Intronic
959036390 3:101370349-101370371 ATGTAAGTATTTGTACAAGTGGG - Intronic
959294763 3:104521558-104521580 ATGTCAGGATTTGGAGGAGTTGG - Intergenic
959908772 3:111739488-111739510 CTGTGTGTGTTTGGAGGAGGAGG + Intronic
960029489 3:113042935-113042957 GGGTGAGTATTTGGTGAAGTAGG - Intergenic
960215781 3:115035582-115035604 TAGTGAGGATATGGAGAAGTTGG + Intronic
960236881 3:115293473-115293495 CTGTGAGTTTTGGCAGCAGTAGG - Intergenic
960357467 3:116671152-116671174 CTCTGAGCCTTTTGAGAAGTAGG - Intronic
960683655 3:120274967-120274989 CTGTCAATAGTTGGAGTAGTGGG - Intronic
961937435 3:130600223-130600245 TTGTGAGGATGTGGAGAAATAGG + Intronic
962059052 3:131905939-131905961 CTGAGAGCATTTTGAGAAGAGGG - Intronic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962838546 3:139212600-139212622 TGGTGAGGATATGGAGAAGTTGG + Intronic
964092556 3:152893682-152893704 CTGTACGTTTCTGGAGAAGTAGG + Intergenic
965187275 3:165481637-165481659 CTGGAAGAATTTGGAGAAGCAGG + Intergenic
965287476 3:166835234-166835256 CGGTGAGGATGTGGAGAAATTGG - Intergenic
965629769 3:170720657-170720679 TGGTGAGGATTTGGAGAAATTGG + Intronic
966451897 3:180072924-180072946 CTATCTGTATTTGGAGAAGAGGG + Intergenic
966877842 3:184333567-184333589 CTGTGAGCGTTTGTAGGAGTGGG + Intronic
971194743 4:24461913-24461935 CTGTGGTCATTTGGAGAAGAGGG - Intergenic
971221884 4:24716551-24716573 ATCTGTGTATTTGAAGAAGTAGG + Intergenic
972315311 4:37920707-37920729 ATGTGAGTGTTTTAAGAAGTGGG + Intronic
973875238 4:55211285-55211307 CAGAGAGGATTTGGAGAAATAGG + Intergenic
974070043 4:57115006-57115028 AGGTGAGTATGTGGAGAAGTGGG + Intergenic
975380199 4:73691088-73691110 CTGAGAGGATGTGGAGAAATAGG + Intergenic
975678672 4:76853239-76853261 CTGTTAACATTTGGAGAATTTGG - Intergenic
976227012 4:82802333-82802355 CAGTGGGGATTTGGAGAAATTGG - Intergenic
978017734 4:103767975-103767997 CAGTGAGGATGTGGAGAAATTGG - Intergenic
978215072 4:106190679-106190701 CTGCGTGTATTTGGATAAGTAGG - Intronic
978497636 4:109377320-109377342 CTGTGAGTATGTAGAGAGATGGG + Intergenic
978918944 4:114158510-114158532 CTTTGAGTATATGTAGCAGTGGG - Intergenic
979166296 4:117535883-117535905 CTAAGAGTATTTAGATAAGTAGG + Intergenic
979176216 4:117667279-117667301 TTGTGAGGATGTGGAGAAATAGG - Intergenic
979683143 4:123483280-123483302 CTGTGAGAGTTTAGAGAAGCAGG - Intergenic
979742519 4:124168590-124168612 CTGTGATCATTTGGAGGAGAAGG - Intergenic
980592437 4:134908126-134908148 CTGTGAATAATTGGAGAGGTAGG - Intergenic
980795323 4:137675052-137675074 CTGAGAGGATGTGGAGAACTAGG - Intergenic
980808802 4:137848890-137848912 CTGAGAGGATGTGGAGAACTAGG + Intergenic
980849234 4:138360241-138360263 CTGAGAGGATGTGGAGAAATAGG + Intergenic
983129765 4:164003644-164003666 CTGTGAGGCTGTGGAGAAATAGG + Intronic
983822384 4:172211908-172211930 ATGTGATTATATTGAGAAGTGGG - Intronic
985000947 4:185482116-185482138 CAGTGAGTCTTTGGTGGAGTTGG + Intergenic
986325322 5:6668796-6668818 CTGTGTGTAAGTGGAGAACTTGG + Exonic
986565658 5:9111165-9111187 CTGTGGGTAGAAGGAGAAGTAGG + Intronic
987770896 5:22303643-22303665 CTATGAGTATTTGGATAATGAGG - Intronic
987902827 5:24035767-24035789 CTGGGAGGATGTGGAGAAATAGG - Intronic
987903002 5:24037839-24037861 CTGGGAGGATGTGGAGAAATAGG - Intronic
989320236 5:40125711-40125733 CTGAGAGGATCTGGAGAAATAGG - Intergenic
991539372 5:67709483-67709505 CTGAGAGGATGTGGAGAAATAGG + Intergenic
991546305 5:67785511-67785533 CTGAGAGGATGTGGAGAAATAGG + Intergenic
991638814 5:68733293-68733315 CTGAGAGTACATGGAGAATTGGG + Intergenic
992777599 5:80102180-80102202 CTATGAGTATTTAGAGAAGAAGG - Intergenic
992800185 5:80288759-80288781 CTGGGAGCATCTGGAGAAGAAGG + Intergenic
993419871 5:87687616-87687638 TGGTGAGGATGTGGAGAAGTTGG - Intergenic
993971526 5:94425748-94425770 CTGTGAGGATCTGGAGAAAAGGG - Intronic
993983304 5:94568576-94568598 CTGTGAGTTTTAAGTGAAGTGGG - Intronic
994056984 5:95428088-95428110 CGGTGAGAAATTGGAGAAGATGG + Intronic
994119062 5:96093379-96093401 TTGTGTGCATTTGGAGAAGCAGG + Intergenic
994321915 5:98404399-98404421 CTCTCTGTATTTGGAGAACTGGG - Intergenic
994458487 5:100046233-100046255 CTGTGATGATTTGGAGGATTAGG + Intergenic
995023826 5:107396758-107396780 CTGAGAGAATTTAGAGAATTAGG + Intronic
995576967 5:113547171-113547193 CTGTGTGTATTTTGAGCAGAAGG - Intronic
996462336 5:123760668-123760690 CTGTGAGTGGTTGGGGGAGTGGG - Intergenic
996617220 5:125456527-125456549 TTGTGAGGATGTGGAGAAATAGG - Intergenic
997090032 5:130846043-130846065 CTGGAAGAATTTGGAGAAGCAGG - Intergenic
998258790 5:140611945-140611967 CTCTGAGCATTAGAAGAAGTGGG + Intergenic
999248284 5:150167004-150167026 GTGAGAGTAGCTGGAGAAGTCGG - Exonic
999612835 5:153389067-153389089 CGGTGAGGATGTGGAGAAATTGG - Intergenic
1002400184 5:178987184-178987206 TTGTGAGCGTGTGGAGAAGTCGG + Intronic
1003388936 6:5695651-5695673 CTGAGAGTAGTTGGAGAGGCTGG - Intronic
1003830363 6:10003366-10003388 CTTTGAGATTTTGGGGAAGTGGG - Intronic
1003984449 6:11420548-11420570 GTCTGTGCATTTGGAGAAGTAGG - Intergenic
1004067822 6:12266499-12266521 CTGGGAGATTTTGGAGAAGAGGG - Intergenic
1004068297 6:12273014-12273036 CTGGGAGATTTTGGAGAAGAGGG - Intergenic
1004469216 6:15914030-15914052 TTGTGAGGATGTGGAGAAATTGG + Intergenic
1004787182 6:18982261-18982283 CTCTGAGTATTAGGAGAGGGAGG - Intergenic
1005003465 6:21265451-21265473 CAGTGAGTAATTGGTGGAGTGGG + Intergenic
1005400326 6:25425592-25425614 CTGTGATTATTTGCTGAAATGGG + Intronic
1006563358 6:34932970-34932992 CAGTGAGTATATGGAGAAATTGG - Intronic
1007214421 6:40226298-40226320 CTGTGTATATTGGGAGAAGCGGG + Intergenic
1007220318 6:40273835-40273857 CTGGAAGAATTTGGAGAAGCAGG - Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007994059 6:46287466-46287488 GTGTGTGTATTTTGGGAAGTGGG - Intronic
1008125357 6:47662186-47662208 CTGGGTGTTTTTGCAGAAGTAGG + Intronic
1008550258 6:52622449-52622471 TTGTGAGGATATGGAGAAGTTGG + Intergenic
1008883296 6:56404239-56404261 CTGCGATTATATGGAGAGGTTGG - Intergenic
1009717777 6:67423078-67423100 CAGAGAGGATTTGGAGAAATAGG - Intergenic
1010225820 6:73487963-73487985 TGGTGAGTATGTGGAGAAATGGG - Intronic
1010847114 6:80722256-80722278 CTGAAAGTATTTGGAGAAACAGG + Intergenic
1010866950 6:80987760-80987782 ATGTTATAATTTGGAGAAGTGGG - Intergenic
1011416301 6:87122989-87123011 TTGTGATTATGTGTAGAAGTTGG - Intergenic
1011447217 6:87454377-87454399 CTGTAAGTATTTGGTCAATTTGG - Intronic
1011758593 6:90532549-90532571 TTATGATTATTTAGAGAAGTGGG - Intronic
1013328558 6:109073490-109073512 CTGTGGGTCTTAGGAGAAGACGG - Intronic
1013842021 6:114407798-114407820 CTGAGAGTATTCAGAAAAGTGGG + Intergenic
1015022568 6:128493841-128493863 CTGGCTGTATCTGGAGAAGTTGG - Intronic
1015337383 6:132055729-132055751 CAGTGAGTATGTTGAGAAATGGG + Intergenic
1015550852 6:134411032-134411054 CTGAAAGAATTTGGAGAAATAGG - Intergenic
1015900845 6:138064199-138064221 GTGTGAGTGTTTGCATAAGTTGG + Intergenic
1016186249 6:141200945-141200967 CTGTGAGTGTTTGGGGACATGGG + Intergenic
1016730809 6:147425571-147425593 TGGTGAGGATGTGGAGAAGTAGG - Intergenic
1016767793 6:147814680-147814702 CTGTAAATATTTTGAGAAGTGGG - Intergenic
1017287435 6:152692150-152692172 CAGTGAGGATTTGGAGAAATTGG - Intergenic
1018378858 6:163239819-163239841 ATGTGAGTGTGTGTAGAAGTAGG - Intronic
1018713137 6:166511805-166511827 CTGGGAGGATGTGGAGAACTTGG + Intronic
1020193964 7:6022693-6022715 CTGTGAGCATTTGGGGAAGGGGG + Exonic
1020942645 7:14560835-14560857 TTGTGAAGATTTGGAGAAATTGG - Intronic
1021496986 7:21286115-21286137 CTGTGAGGATGTGAAGAAATTGG + Intergenic
1022603803 7:31788539-31788561 CTGTGAGAAATTGGAGAGGGTGG - Intronic
1023692220 7:42801687-42801709 CTGGGAGGATGTGGAGAAATAGG + Intergenic
1025009012 7:55380664-55380686 CAGTGAGTAATTGGAGGAGGAGG + Intronic
1025715205 7:63949820-63949842 CTATGAGAATATGGAGGAGTGGG + Intergenic
1026100224 7:67378335-67378357 TTGTGAGTAGGTGGAGCAGTGGG + Intergenic
1026256570 7:68717095-68717117 CTGAGAGAAGTTGAAGAAGTTGG + Intergenic
1027263719 7:76482623-76482645 CTGTGACTATCTGGAGCAGCAGG + Exonic
1027491709 7:78835212-78835234 TCGTGAGGATTTGGAGAAATTGG - Intronic
1027945060 7:84734173-84734195 TGGTGAGGCTTTGGAGAAGTAGG + Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1027999712 7:85478271-85478293 CTGCCAGTATTTGCAGCAGTAGG - Intergenic
1028013494 7:85678870-85678892 CTGTGATCCTTTGGAGAAGAAGG + Intergenic
1028338613 7:89690153-89690175 CACTGAGTAGATGGAGAAGTGGG + Intergenic
1029190256 7:98766873-98766895 CCGTGAGTTCATGGAGAAGTGGG + Intergenic
1029918998 7:104242288-104242310 CTTTTAGTCTTTTGAGAAGTAGG + Intergenic
1029953107 7:104608004-104608026 CTGAGAGGATGTGGAGAAATAGG + Intronic
1030674910 7:112374440-112374462 CTGTGATGATTTGGAGAATTAGG - Intergenic
1032941227 7:136794917-136794939 CTGTGAGGATGTGGAGAAAAGGG + Intergenic
1033030093 7:137818086-137818108 CTGGGAATATTTTGAGAAGATGG + Intronic
1034105381 7:148485183-148485205 ATATGAGTCTTTGGAGAGGTAGG + Intergenic
1034381622 7:150700886-150700908 CTTAGAGATTTTGGAGAAGTAGG - Intergenic
1034905034 7:154936697-154936719 AGGTGAGGATTTGGAGAAATTGG - Intronic
1036285893 8:7443889-7443911 CAGTGGGTATTGGGAGAAGCCGG - Intronic
1036335580 8:7867640-7867662 CAGTGGGTATTGGGAGAAGCCGG + Intronic
1037234411 8:16701007-16701029 CTGAGATGACTTGGAGAAGTAGG - Intergenic
1039256118 8:35720680-35720702 TTATGAGTGGTTGGAGAAGTAGG + Intronic
1039353261 8:36786082-36786104 CTCTAAGCCTTTGGAGAAGTTGG + Intronic
1039600191 8:38830023-38830045 CTGTAAGTATCTGGCCAAGTGGG + Intronic
1040377281 8:46838564-46838586 CTGTGATGATCTGGAGAATTAGG + Intergenic
1040383458 8:46895034-46895056 CTGTGAATCTTTGAAGGAGTAGG - Intergenic
1040561392 8:48525929-48525951 CTGGGAGTAGTTGGTGTAGTCGG + Intergenic
1040734845 8:50492372-50492394 CGGAGAGGATGTGGAGAAGTAGG - Intronic
1041008090 8:53515300-53515322 CTGTGAGTATCTGGTTAGGTGGG - Intergenic
1041542126 8:58997151-58997173 CTGAGAGTATTTGGAGGAAAAGG - Intronic
1042505849 8:69559335-69559357 CTGTGATTATTTGGGAAATTTGG + Intronic
1042953111 8:74221363-74221385 CTGAGGGGATTTGCAGAAGTTGG - Intergenic
1043284973 8:78516809-78516831 TTTTGAGGATTTGGAGCAGTAGG + Intronic
1044106114 8:88209271-88209293 CTTTGAGTATGTGGAGGAGGAGG - Intronic
1044377546 8:91494386-91494408 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1044772299 8:95649099-95649121 ATGAGAGTAGTTGTAGAAGTCGG + Intergenic
1044934572 8:97280497-97280519 CTGTGAGTGTTCTAAGAAGTGGG - Intergenic
1045018597 8:98021268-98021290 CTCTGAGCATTTGCAGATGTAGG - Exonic
1047268182 8:123328728-123328750 CTGTGAGAAGGTGGAGAAGTGGG + Intronic
1047297792 8:123586743-123586765 TTGTGAGTATTTGGTTAATTAGG + Intergenic
1049426995 8:142542133-142542155 CAGTGAGTGGTTGGGGAAGTCGG - Exonic
1050181756 9:2930639-2930661 TGGTGAGTATGTGGAGAAATTGG - Intergenic
1050195864 9:3083937-3083959 CTGGGAGAATTGGGAGATGTTGG - Intergenic
1050310297 9:4345810-4345832 GAGTGAGAATTTGGGGAAGTGGG + Intronic
1050631289 9:7561370-7561392 CTATCAGTCTTTGGAGAACTTGG + Intergenic
1051218789 9:14827075-14827097 CTGGAAGAATTTGGAGAAGTAGG + Intronic
1051321823 9:15913697-15913719 TTGTGATCATTTGGAGAAGAGGG + Intronic
1051830713 9:21272965-21272987 TGGTGAGGATTTGGAGAAATAGG - Intergenic
1052092529 9:24346666-24346688 TTGTGAGTTCTTGGAAAAGTAGG + Intergenic
1052144523 9:25031717-25031739 CATTGAGTATTTGGAGAAACTGG + Intergenic
1055073097 9:72187654-72187676 CTGGAAGAATTTGGAGAAGCAGG + Intronic
1055269698 9:74544141-74544163 CTGAGAGTGTTTGGAGGAGGCGG - Intronic
1055472661 9:76628831-76628853 AAGTGTGTGTTTGGAGAAGTGGG - Intronic
1056669647 9:88615514-88615536 CTGTGAGGTTGTGGAGAAATAGG - Intergenic
1058285001 9:103166664-103166686 CAGTGAGGATGTGGAGAAGTGGG - Intergenic
1058461182 9:105184650-105184672 CTGTGAGTTTTTTGAGATATAGG + Intergenic
1058725008 9:107794472-107794494 CTGTCACTATCTGGAGAAGCTGG + Intergenic
1059113269 9:111577318-111577340 TGGTGAGTATGTAGAGAAGTTGG + Intronic
1060168093 9:121436905-121436927 CTGGGAGGATGTGGAGAAATAGG + Intergenic
1060348578 9:122837879-122837901 CTGAGAGCATCTGGAGAAGAAGG + Intergenic
1062312671 9:135947676-135947698 CTGGGAGGATTTGGGGAAGCCGG - Intronic
1203412284 Un_KI270579v1:29207-29229 CAGTGAGCATTTGGAGCACTTGG - Intergenic
1185767583 X:2738130-2738152 TTGTGTGTATTTTGAGGAGTGGG + Intronic
1186267473 X:7847954-7847976 TTGTGGGTAGTTGGAGAAGGAGG - Intergenic
1186376630 X:9010343-9010365 TTGTGGGTAGTTGGAGAAGGAGG - Intergenic
1186680904 X:11872890-11872912 CTGTGAGGATGTGGAGAAATTGG + Intergenic
1187072985 X:15907105-15907127 TTGTCAGTATTAAGAGAAGTCGG - Intergenic
1187334618 X:18371353-18371375 CTGGGAGAATTTGGAGGAGCAGG + Intergenic
1187744244 X:22390877-22390899 CTGTGAGGATTTAAAGAAATAGG - Intergenic
1187777450 X:22778105-22778127 CTGTGAATATGTGAAGAAATTGG - Intergenic
1188202955 X:27315742-27315764 TTGTGAGGATGTGGAGAAATTGG + Intergenic
1188523066 X:31059884-31059906 CTATGATTATTTGGAGATTTGGG + Intergenic
1189260325 X:39674047-39674069 GTGTGTGTATGTGGACAAGTGGG - Intergenic
1190106295 X:47563203-47563225 CTGTGTGTATGTGCAGATGTAGG - Intronic
1190757654 X:53414796-53414818 CAGTGAGGAATTAGAGAAGTTGG - Exonic
1191145898 X:57165048-57165070 CTATGAGGATGTGGAGAAATAGG + Intergenic
1191765179 X:64690600-64690622 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1192216420 X:69162507-69162529 CTGTGAGTATTTGTGGTGGTGGG - Exonic
1195131492 X:101858382-101858404 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1195795209 X:108639894-108639916 TGGTGAGGATGTGGAGAAGTTGG + Intronic
1195858485 X:109356053-109356075 GTGTGTGTCTTTGGAGAGGTGGG + Intergenic
1197359630 X:125484252-125484274 TGGTGAGGATGTGGAGAAGTTGG + Intergenic
1197874828 X:131091598-131091620 CTGAGAGTGTTTGTAGATGTGGG + Intergenic
1198705964 X:139448321-139448343 CTGTGTGTAAGTGGAGAACTTGG + Intergenic
1199665199 X:150090940-150090962 CTGAGAGAATGTGGAGAAGGTGG + Intergenic
1200894830 Y:8364149-8364171 CTGTGAGGATCTGGAGAATTAGG - Intergenic
1200907752 Y:8501974-8501996 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1201754566 Y:17471994-17472016 TTGAGAGTATGTGGAGAAATTGG + Intergenic
1201799199 Y:17936302-17936324 TTGAGAGTATGTGGAGAAATTGG + Intergenic
1201802354 Y:17969654-17969676 TTGAGAGTATGTGGAGAAATTGG - Intergenic
1201846986 Y:18433991-18434013 TTGAGAGTATGTGGAGAAATTGG - Intergenic
1202352933 Y:24013239-24013261 TTGAGAGTATGTGGAGAAATTGG + Intergenic
1202517846 Y:25656876-25656898 TTGAGAGTATGTGGAGAAATTGG - Intergenic