ID: 1110470009

View in Genome Browser
Species Human (GRCh38)
Location 13:75848891-75848913
Sequence TGGTGTGAATGCAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2647
Summary {0: 1, 1: 0, 2: 72, 3: 479, 4: 2095}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110470009_1110470015 22 Left 1110470009 13:75848891-75848913 CCCTTTTCCCTGCATTCACACCA 0: 1
1: 0
2: 72
3: 479
4: 2095
Right 1110470015 13:75848936-75848958 TTGATTATGGCCATTCTTGCAGG 0: 612
1: 1069
2: 1033
3: 855
4: 2407
1110470009_1110470014 9 Left 1110470009 13:75848891-75848913 CCCTTTTCCCTGCATTCACACCA 0: 1
1: 0
2: 72
3: 479
4: 2095
Right 1110470014 13:75848923-75848945 ATTTTTTGAGTTGTTGATTATGG 0: 1
1: 16
2: 220
3: 623
4: 1407
1110470009_1110470016 29 Left 1110470009 13:75848891-75848913 CCCTTTTCCCTGCATTCACACCA 0: 1
1: 0
2: 72
3: 479
4: 2095
Right 1110470016 13:75848943-75848965 TGGCCATTCTTGCAGGAGTAAGG 0: 835
1: 1117
2: 909
3: 572
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110470009 Original CRISPR TGGTGTGAATGCAGGGAAAA GGG (reversed) Intronic
Too many off-targets to display for this crispr