ID: 1110477058

View in Genome Browser
Species Human (GRCh38)
Location 13:75928417-75928439
Sequence ATGTATTAGCGGCATGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110477054_1110477058 10 Left 1110477054 13:75928384-75928406 CCTCTTTCTTTTGTAAATTGCCC 0: 1592
1: 1792
2: 1635
3: 5247
4: 9684
Right 1110477058 13:75928417-75928439 ATGTATTAGCGGCATGAAAATGG No data
1110477055_1110477058 -10 Left 1110477055 13:75928404-75928426 CCCAGTCTCATGTATGTATTAGC No data
Right 1110477058 13:75928417-75928439 ATGTATTAGCGGCATGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110477058 Original CRISPR ATGTATTAGCGGCATGAAAA TGG Intergenic
No off target data available for this crispr