ID: 1110477410

View in Genome Browser
Species Human (GRCh38)
Location 13:75932694-75932716
Sequence TCTACCACATAAAACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110477410_1110477414 -4 Left 1110477410 13:75932694-75932716 CCTTCCTGGTTTTATGTGGTAGA 0: 1
1: 0
2: 2
3: 9
4: 134
Right 1110477414 13:75932713-75932735 TAGACTAAAGAGTCTTGGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 116
1110477410_1110477412 -9 Left 1110477410 13:75932694-75932716 CCTTCCTGGTTTTATGTGGTAGA 0: 1
1: 0
2: 2
3: 9
4: 134
Right 1110477412 13:75932708-75932730 TGTGGTAGACTAAAGAGTCTTGG 0: 1
1: 0
2: 0
3: 11
4: 122
1110477410_1110477413 -8 Left 1110477410 13:75932694-75932716 CCTTCCTGGTTTTATGTGGTAGA 0: 1
1: 0
2: 2
3: 9
4: 134
Right 1110477413 13:75932709-75932731 GTGGTAGACTAAAGAGTCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110477410 Original CRISPR TCTACCACATAAAACCAGGA AGG (reversed) Intergenic
902113491 1:14102428-14102450 TCTATCAGATGCAACCAGGAGGG - Intergenic
906344332 1:45005853-45005875 GCTTCCACACAAAACCAGGCAGG + Exonic
908085757 1:60632097-60632119 TTTTCCACAAAAAACAAGGAGGG - Intergenic
909256113 1:73424454-73424476 GCCACCACACAAAACCAGCATGG - Intergenic
910594571 1:88965686-88965708 AATACCAAATAAAACAAGGAGGG - Intronic
913031003 1:114902527-114902549 GTTACCACATAAGAGCAGGAGGG + Intronic
915142185 1:153774780-153774802 TGTCCCAATTAAAACCAGGATGG + Intronic
917934794 1:179855311-179855333 TGCAACACATAAAACCAGTAAGG + Intronic
918778377 1:188666797-188666819 TCTAAAACAGTAAACCAGGAGGG - Intergenic
921906643 1:220502345-220502367 TCTGCCACCTACCACCAGGATGG - Intergenic
1064537678 10:16374446-16374468 TCTACCAAATAAAAACTGGGGGG - Intergenic
1066625460 10:37401477-37401499 TTTACAACATAAAGCCAAGAGGG + Intergenic
1068813602 10:61284674-61284696 ACTACAACATAACACCATGAAGG - Intergenic
1072966648 10:99979499-99979521 TCTCCCACACAACACCAGGAAGG - Intronic
1074308644 10:112302005-112302027 TCTACAACACAAAACCTGGCTGG - Intronic
1075219387 10:120571554-120571576 ACAACAACAAAAAACCAGGAAGG - Intronic
1075219595 10:120573068-120573090 ACAACAACAAAAAACCAGGAAGG + Intronic
1077858682 11:6155892-6155914 TCTAACACATAAACACAGAATGG + Intergenic
1078061628 11:8049543-8049565 TATACCACATAATACCACCATGG - Intronic
1078766032 11:14299525-14299547 CATACTACATAAAACCTGGAGGG - Intronic
1079646822 11:22874133-22874155 TCTAACACGCAAAACCAGGTAGG - Intergenic
1081317982 11:41654392-41654414 TATACTATATAAAACCAGTATGG - Intergenic
1087007018 11:93480802-93480824 TATCCCTCATAAAAACAGGATGG - Intronic
1088762184 11:112942156-112942178 TGTAACCCATAAAACCAGGAAGG + Intergenic
1088939336 11:114437840-114437862 TCTCTCTCATAAAACCAGGTAGG + Intronic
1090338397 11:125992016-125992038 TCTAGAACATAGAACCAAGAAGG + Intronic
1092802147 12:12179618-12179640 TCTTCCACATAATCCTAGGATGG - Intronic
1097373393 12:58811661-58811683 ACTTCCCCGTAAAACCAGGAGGG + Intronic
1098119195 12:67217835-67217857 TCTAGGTCATAACACCAGGAGGG + Intergenic
1100081664 12:90860013-90860035 TCTTCCATTTGAAACCAGGACGG - Intergenic
1101531106 12:105574453-105574475 GCAACCACTTAAAACTAGGAAGG - Intergenic
1102035883 12:109770183-109770205 CCTCCCAGTTAAAACCAGGAGGG - Exonic
1102286918 12:111665070-111665092 TTTACCCCCTAAATCCAGGATGG - Intronic
1104236731 12:126945548-126945570 TGTGTCACATAGAACCAGGAAGG - Intergenic
1105910073 13:24855983-24856005 TGGAACACATAAAACCAAGAAGG - Intronic
1108441826 13:50461649-50461671 TCTCCTACATGAAACCAGTAGGG + Intronic
1110477410 13:75932694-75932716 TCTACCACATAAAACCAGGAAGG - Intergenic
1111848175 13:93538124-93538146 TTTTCCACATAAACCCAGAAAGG - Intronic
1112647045 13:101345811-101345833 TCTACAACATAAGAGCAAGAAGG - Intronic
1113827153 13:113265185-113265207 TCTACCACAAAATACCAGTGGGG + Intronic
1116462648 14:45195407-45195429 TCTACTCCATAAAAACAGAAAGG - Intronic
1117273738 14:54171129-54171151 ACTACCACATAAAATCCAGAGGG - Intergenic
1118304728 14:64646206-64646228 TCTACCGCAAAAAAAAAGGAGGG - Intergenic
1118805876 14:69236560-69236582 TCTGCCACAGACAACCAGGGTGG - Intronic
1123817940 15:23998691-23998713 TCTAGCAAGTAATACCAGGAAGG - Intergenic
1124232768 15:27959805-27959827 TCTAACCCATAAAACCAAAAAGG + Intronic
1124851343 15:33341602-33341624 TCTACCATCTAGAAGCAGGAGGG + Intronic
1125192567 15:37010541-37010563 TCTACCAAAAAAAATTAGGAAGG - Intronic
1125821488 15:42635936-42635958 TTTATCACAGAAAATCAGGAGGG + Intronic
1127004484 15:54550861-54550883 TTTCTCACATAAAACCATGAAGG + Intronic
1131795472 15:96011421-96011443 TCAATCACATGAAACAAGGAGGG + Intergenic
1133575565 16:7085874-7085896 TCTGCCCCATCAAACCAGGATGG + Intronic
1135636704 16:24083038-24083060 TTTACCAAATAATACAAGGATGG + Intronic
1135867068 16:26113590-26113612 TCACCCACATGAAACCAAGAAGG - Intronic
1135888609 16:26336725-26336747 AGCACCACATAAATCCAGGATGG + Intergenic
1136859690 16:33691003-33691025 TAGAGCACAGAAAACCAGGATGG + Intergenic
1138010934 16:53379559-53379581 ACTAACACATGCAACCAGGAAGG - Intergenic
1138366726 16:56484938-56484960 AAAACAACATAAAACCAGGAGGG + Intronic
1203121196 16_KI270728v1_random:1539182-1539204 TAGAGCACAGAAAACCAGGATGG + Intergenic
1149605275 17:57920361-57920383 TCAGCAAGATAAAACCAGGATGG - Intronic
1149928759 17:60728103-60728125 TATACCACCAAAAACCAGGCCGG - Intronic
1151287576 17:73124044-73124066 TATCCCTCATAAAAACAGGAAGG - Intergenic
1159499415 18:69250730-69250752 CCTAAGATATAAAACCAGGATGG - Intergenic
1161409450 19:4108761-4108783 TCAGCCACACAAAACGAGGATGG + Intronic
1162519921 19:11173740-11173762 TCTCCCCCATAAGACCAGGAGGG + Intronic
1165344402 19:35235258-35235280 TCAACCACATAAAACAACTAAGG + Intergenic
1166819348 19:45567793-45567815 CCTCACTCATAAAACCAGGATGG + Intronic
1168347351 19:55656936-55656958 TCTGCCACACAACACCTGGATGG + Intronic
1168550904 19:57292675-57292697 TCTCCCAAATAAAATAAGGAGGG - Exonic
925535177 2:4908977-4908999 TCAACAACATATAACCAGGATGG - Intergenic
928400181 2:30972101-30972123 TCTCCAGCATGAAACCAGGAGGG + Intronic
930063132 2:47307453-47307475 TCAACCAAACAAAACCAGAAGGG - Intergenic
931131243 2:59338716-59338738 TCTGCCTCTTAAAACCAGTAAGG - Intergenic
933297254 2:80504620-80504642 TCTACCACATGGAACCTGAAGGG + Intronic
934122444 2:88853338-88853360 TCTGCCAAGGAAAACCAGGAAGG - Intergenic
939549456 2:143595999-143596021 TCTACTAAAGAAAACCAAGATGG - Intronic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
943851413 2:192727890-192727912 TCTCACACATAAAAACAAGAGGG + Intergenic
946057383 2:216913972-216913994 CCTTCCACATACAACCAGGGTGG - Intergenic
947062165 2:226179339-226179361 TCTCCCACATAAAACAAGGAAGG - Intergenic
1170978373 20:21188144-21188166 TCTGCCACAGAAATACAGGAGGG - Intronic
1173885464 20:46453899-46453921 GCTACCAGAAAAAAACAGGAAGG - Intergenic
1177670091 21:24213777-24213799 ACTAGCACAGAAAACAAGGAGGG - Intergenic
1178799763 21:35781810-35781832 TCTAGGCCATAAAATCAGGAGGG + Intronic
1179080168 21:38163390-38163412 TCTACCAAATAAACCCATGTAGG - Intronic
1179478339 21:41662136-41662158 TCTAACCCATAAAACAAGGGAGG + Intergenic
1182153964 22:28051614-28051636 TCTGCCACATTAACCCAGTAGGG + Intronic
949454821 3:4227418-4227440 TCTACAACAGAAAACCACAAGGG + Intronic
950706027 3:14782484-14782506 TCAATCACATACAACAAGGATGG - Intergenic
951074660 3:18375365-18375387 TCTAGCACAAAAAAACACGATGG + Intronic
953306125 3:41831307-41831329 TCTATCACATAAAAAGAAGAGGG + Intronic
954260350 3:49434176-49434198 ACTTCCACTTAAAACCAAGATGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955236349 3:57143231-57143253 TCTGCCACCTTACACCAGGATGG + Intronic
956797135 3:72727396-72727418 TCTACAGGATAAAAACAGGAAGG + Intergenic
959424089 3:106164691-106164713 CCTCCCAGATTAAACCAGGAAGG + Intergenic
960926339 3:122798282-122798304 TCTACCATAAAAAACAAGGTTGG - Intronic
964499345 3:157331193-157331215 TCCACCACATGAGTCCAGGAGGG + Intronic
974083540 4:57236397-57236419 TCTGACACATAAACCCTGGAAGG - Intergenic
975878419 4:78871438-78871460 TCTATCAACCAAAACCAGGAGGG - Intronic
976320465 4:83708622-83708644 TCCAACACAGAAAAGCAGGAGGG - Intergenic
978041923 4:104076767-104076789 TCTAAGACCTAAAACCATGAAGG - Intergenic
979786244 4:124718518-124718540 TGTATCACATAAAACCAGGATGG - Intergenic
980769957 4:137358434-137358456 TCTTGCACATAGAACCAGTAAGG + Intergenic
981670122 4:147277148-147277170 TATACCACATACAACCTGGGAGG - Intergenic
981754877 4:148131690-148131712 TCTAACACATTAGACCAGTAAGG - Intronic
981898787 4:149836548-149836570 ACTACCACATAAAATCAGTGTGG - Intergenic
982421528 4:155204512-155204534 TCTTTCACATAAATCCAGCAGGG - Intergenic
983637513 4:169913005-169913027 TCTACGATGTAAAGCCAGGATGG + Intergenic
983906311 4:173186041-173186063 TGTGCCACATAAAAGGAGGAGGG + Intronic
985064610 4:186108030-186108052 ACTACCACAGAAATCCAGGAGGG - Intronic
986040762 5:3992182-3992204 TATTGCACAGAAAACCAGGAGGG - Intergenic
987624583 5:20381550-20381572 CCTACCCCCTAAAACAAGGAAGG + Intronic
989269080 5:39510824-39510846 TCTAGCAGAAATAACCAGGAAGG - Intergenic
990093612 5:52085161-52085183 ATTAAAACATAAAACCAGGATGG + Intergenic
990709742 5:58566958-58566980 TCTAACACTCAAAGCCAGGAGGG - Intergenic
991037451 5:62142199-62142221 TCTGACGCATAAAAGCAGGAGGG + Intergenic
993779880 5:92053614-92053636 TCAAGCATATAAAACCAGAAAGG + Intergenic
994023889 5:95059916-95059938 TCTAGTCCATAAACCCAGGATGG + Intronic
994212508 5:97102223-97102245 TCTACCATATAAAAACAAGCTGG - Intronic
994879427 5:105468735-105468757 TCTACTACATGAAAACTGGAAGG - Intergenic
994975898 5:106805186-106805208 TCTTGCACATAAAACCAAGAAGG + Intergenic
995172750 5:109136416-109136438 TCTAAAACATAAAACCAGAAAGG - Intronic
1001463500 5:171940315-171940337 TCTAATACATAGAACAAGGAGGG + Intronic
1005390060 6:25323920-25323942 TCTAGCTCATAAAATAAGGATGG + Intronic
1011888834 6:92131288-92131310 TCTATCACACAAAAACAGAATGG + Intergenic
1015924768 6:138297562-138297584 TCTACCAGATAAAAGCAAAAGGG - Intronic
1017887266 6:158609568-158609590 TGGAACACAGAAAACCAGGACGG - Intronic
1018161644 6:161050208-161050230 TCAACCACGTAAATACAGGATGG + Intronic
1020927472 7:14349734-14349756 TCTACAACCTAAAACCAGTTTGG - Intronic
1022512146 7:30944636-30944658 TCTCCCAGAAAAAACGAGGAAGG - Intronic
1022958232 7:35401047-35401069 TCTTCCAAATAACACAAGGAAGG + Intergenic
1023615603 7:42016527-42016549 TTTACCACATAAAACGGTGAGGG - Intronic
1026649175 7:72199941-72199963 TCTACCTCATGAAACAATGACGG + Intronic
1032107608 7:129047467-129047489 TCTATCACATAAAACAACCATGG + Intronic
1033019446 7:137707860-137707882 TCTTCCAGTTAATACCAGGATGG + Intronic
1036408565 8:8477711-8477733 TATACCAGATAAAAGCAGAAGGG + Intergenic
1046351811 8:113025232-113025254 ACTACCACATAAAATCGGAAAGG - Intronic
1048304395 8:133273462-133273484 TCTTCAACATAAAACAAGGATGG + Intronic
1049440540 8:142607530-142607552 TATAACAAATAAAACCAGAATGG + Intergenic
1050002037 9:1087369-1087391 TCTAACATATAGACCCAGGAGGG + Intergenic
1061412851 9:130430567-130430589 TCTGCCTGATGAAACCAGGAGGG - Exonic
1187990263 X:24863301-24863323 TCTACAACACAAAACCAAGGTGG + Intronic
1194881041 X:99252846-99252868 TCTATCACATAACAACAGTAGGG + Intergenic
1199065081 X:143406520-143406542 ACTACCAAGTAGAACCAGGATGG - Intergenic
1200828326 Y:7665830-7665852 TTTTGCAAATAAAACCAGGATGG + Intergenic