ID: 1110479660

View in Genome Browser
Species Human (GRCh38)
Location 13:75959542-75959564
Sequence CTGAGTCAGGGGAAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110479652_1110479660 -6 Left 1110479652 13:75959525-75959547 CCAGCTGGCCCTCGGAGCTGAGT No data
Right 1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110479660 Original CRISPR CTGAGTCAGGGGAAGGAGGC TGG Intergenic
No off target data available for this crispr