ID: 1110488184

View in Genome Browser
Species Human (GRCh38)
Location 13:76070735-76070757
Sequence CACACAAATGGACCAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110488184_1110488192 24 Left 1110488184 13:76070735-76070757 CCCTGGGTTGGTCCATTTGTGTG No data
Right 1110488192 13:76070782-76070804 GGTGATTTATTAAGAAAATTGGG No data
1110488184_1110488191 23 Left 1110488184 13:76070735-76070757 CCCTGGGTTGGTCCATTTGTGTG No data
Right 1110488191 13:76070781-76070803 GGGTGATTTATTAAGAAAATTGG No data
1110488184_1110488189 2 Left 1110488184 13:76070735-76070757 CCCTGGGTTGGTCCATTTGTGTG No data
Right 1110488189 13:76070760-76070782 TATAAAGGAATAACTGAGACTGG No data
1110488184_1110488190 3 Left 1110488184 13:76070735-76070757 CCCTGGGTTGGTCCATTTGTGTG No data
Right 1110488190 13:76070761-76070783 ATAAAGGAATAACTGAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110488184 Original CRISPR CACACAAATGGACCAACCCA GGG (reversed) Intergenic
No off target data available for this crispr