ID: 1110488189

View in Genome Browser
Species Human (GRCh38)
Location 13:76070760-76070782
Sequence TATAAAGGAATAACTGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110488183_1110488189 5 Left 1110488183 13:76070732-76070754 CCACCCTGGGTTGGTCCATTTGT No data
Right 1110488189 13:76070760-76070782 TATAAAGGAATAACTGAGACTGG No data
1110488185_1110488189 1 Left 1110488185 13:76070736-76070758 CCTGGGTTGGTCCATTTGTGTGG No data
Right 1110488189 13:76070760-76070782 TATAAAGGAATAACTGAGACTGG No data
1110488184_1110488189 2 Left 1110488184 13:76070735-76070757 CCCTGGGTTGGTCCATTTGTGTG No data
Right 1110488189 13:76070760-76070782 TATAAAGGAATAACTGAGACTGG No data
1110488178_1110488189 20 Left 1110488178 13:76070717-76070739 CCTTAAGAAAAAGTCCCACCCTG No data
Right 1110488189 13:76070760-76070782 TATAAAGGAATAACTGAGACTGG No data
1110488182_1110488189 6 Left 1110488182 13:76070731-76070753 CCCACCCTGGGTTGGTCCATTTG No data
Right 1110488189 13:76070760-76070782 TATAAAGGAATAACTGAGACTGG No data
1110488188_1110488189 -10 Left 1110488188 13:76070747-76070769 CCATTTGTGTGGTTATAAAGGAA No data
Right 1110488189 13:76070760-76070782 TATAAAGGAATAACTGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110488189 Original CRISPR TATAAAGGAATAACTGAGAC TGG Intergenic
No off target data available for this crispr