ID: 1110488462

View in Genome Browser
Species Human (GRCh38)
Location 13:76073596-76073618
Sequence TTTTTTGTAAGCAGCTGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110488462_1110488466 11 Left 1110488462 13:76073596-76073618 CCTAAACAGCTGCTTACAAAAAA No data
Right 1110488466 13:76073630-76073652 ACTTACAGGCTGAAGGTGAAGGG No data
1110488462_1110488463 -3 Left 1110488462 13:76073596-76073618 CCTAAACAGCTGCTTACAAAAAA No data
Right 1110488463 13:76073616-76073638 AAACTCACAATGACACTTACAGG No data
1110488462_1110488467 12 Left 1110488462 13:76073596-76073618 CCTAAACAGCTGCTTACAAAAAA No data
Right 1110488467 13:76073631-76073653 CTTACAGGCTGAAGGTGAAGGGG No data
1110488462_1110488464 4 Left 1110488462 13:76073596-76073618 CCTAAACAGCTGCTTACAAAAAA No data
Right 1110488464 13:76073623-76073645 CAATGACACTTACAGGCTGAAGG No data
1110488462_1110488465 10 Left 1110488462 13:76073596-76073618 CCTAAACAGCTGCTTACAAAAAA No data
Right 1110488465 13:76073629-76073651 CACTTACAGGCTGAAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110488462 Original CRISPR TTTTTTGTAAGCAGCTGTTT AGG (reversed) Intergenic
No off target data available for this crispr