ID: 1110488463

View in Genome Browser
Species Human (GRCh38)
Location 13:76073616-76073638
Sequence AAACTCACAATGACACTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110488462_1110488463 -3 Left 1110488462 13:76073596-76073618 CCTAAACAGCTGCTTACAAAAAA No data
Right 1110488463 13:76073616-76073638 AAACTCACAATGACACTTACAGG No data
1110488461_1110488463 -2 Left 1110488461 13:76073595-76073617 CCCTAAACAGCTGCTTACAAAAA No data
Right 1110488463 13:76073616-76073638 AAACTCACAATGACACTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110488463 Original CRISPR AAACTCACAATGACACTTAC AGG Intergenic
No off target data available for this crispr