ID: 1110488467

View in Genome Browser
Species Human (GRCh38)
Location 13:76073631-76073653
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110488462_1110488467 12 Left 1110488462 13:76073596-76073618 CCTAAACAGCTGCTTACAAAAAA No data
Right 1110488467 13:76073631-76073653 CTTACAGGCTGAAGGTGAAGGGG No data
1110488461_1110488467 13 Left 1110488461 13:76073595-76073617 CCCTAAACAGCTGCTTACAAAAA No data
Right 1110488467 13:76073631-76073653 CTTACAGGCTGAAGGTGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110488467 Original CRISPR CTTACAGGCTGAAGGTGAAG GGG Intergenic
No off target data available for this crispr