ID: 1110495360

View in Genome Browser
Species Human (GRCh38)
Location 13:76161738-76161760
Sequence CAGTGTAGTAAAGCTGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110495360_1110495363 3 Left 1110495360 13:76161738-76161760 CCTTCAACAGCTTTACTACACTG No data
Right 1110495363 13:76161764-76161786 TGGGCAGATAAGAGAAAATGAGG No data
1110495360_1110495364 24 Left 1110495360 13:76161738-76161760 CCTTCAACAGCTTTACTACACTG No data
Right 1110495364 13:76161785-76161807 GGCCAGCATACATACTAACCAGG No data
1110495360_1110495366 27 Left 1110495360 13:76161738-76161760 CCTTCAACAGCTTTACTACACTG No data
Right 1110495366 13:76161788-76161810 CAGCATACATACTAACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110495360 Original CRISPR CAGTGTAGTAAAGCTGTTGA AGG (reversed) Intergenic
No off target data available for this crispr