ID: 1110507234 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:76301155-76301177 |
Sequence | TAGCTTACCCTCTCAAGAGG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1110507234_1110507238 | 23 | Left | 1110507234 | 13:76301155-76301177 | CCACCTCTTGAGAGGGTAAGCTA | No data | ||
Right | 1110507238 | 13:76301201-76301223 | AATCTACCCCAGCCGGTGATGGG | No data | ||||
1110507234_1110507236 | 16 | Left | 1110507234 | 13:76301155-76301177 | CCACCTCTTGAGAGGGTAAGCTA | No data | ||
Right | 1110507236 | 13:76301194-76301216 | TTTCTGAAATCTACCCCAGCCGG | No data | ||||
1110507234_1110507237 | 22 | Left | 1110507234 | 13:76301155-76301177 | CCACCTCTTGAGAGGGTAAGCTA | No data | ||
Right | 1110507237 | 13:76301200-76301222 | AAATCTACCCCAGCCGGTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1110507234 | Original CRISPR | TAGCTTACCCTCTCAAGAGG TGG (reversed) | Intergenic | ||