ID: 1110507234

View in Genome Browser
Species Human (GRCh38)
Location 13:76301155-76301177
Sequence TAGCTTACCCTCTCAAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110507234_1110507238 23 Left 1110507234 13:76301155-76301177 CCACCTCTTGAGAGGGTAAGCTA No data
Right 1110507238 13:76301201-76301223 AATCTACCCCAGCCGGTGATGGG No data
1110507234_1110507236 16 Left 1110507234 13:76301155-76301177 CCACCTCTTGAGAGGGTAAGCTA No data
Right 1110507236 13:76301194-76301216 TTTCTGAAATCTACCCCAGCCGG No data
1110507234_1110507237 22 Left 1110507234 13:76301155-76301177 CCACCTCTTGAGAGGGTAAGCTA No data
Right 1110507237 13:76301200-76301222 AAATCTACCCCAGCCGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110507234 Original CRISPR TAGCTTACCCTCTCAAGAGG TGG (reversed) Intergenic