ID: 1110507235

View in Genome Browser
Species Human (GRCh38)
Location 13:76301158-76301180
Sequence TTTTAGCTTACCCTCTCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110507235_1110507238 20 Left 1110507235 13:76301158-76301180 CCTCTTGAGAGGGTAAGCTAAAA No data
Right 1110507238 13:76301201-76301223 AATCTACCCCAGCCGGTGATGGG No data
1110507235_1110507236 13 Left 1110507235 13:76301158-76301180 CCTCTTGAGAGGGTAAGCTAAAA No data
Right 1110507236 13:76301194-76301216 TTTCTGAAATCTACCCCAGCCGG No data
1110507235_1110507237 19 Left 1110507235 13:76301158-76301180 CCTCTTGAGAGGGTAAGCTAAAA No data
Right 1110507237 13:76301200-76301222 AAATCTACCCCAGCCGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110507235 Original CRISPR TTTTAGCTTACCCTCTCAAG AGG (reversed) Intergenic
No off target data available for this crispr