ID: 1110507238

View in Genome Browser
Species Human (GRCh38)
Location 13:76301201-76301223
Sequence AATCTACCCCAGCCGGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110507235_1110507238 20 Left 1110507235 13:76301158-76301180 CCTCTTGAGAGGGTAAGCTAAAA No data
Right 1110507238 13:76301201-76301223 AATCTACCCCAGCCGGTGATGGG No data
1110507234_1110507238 23 Left 1110507234 13:76301155-76301177 CCACCTCTTGAGAGGGTAAGCTA No data
Right 1110507238 13:76301201-76301223 AATCTACCCCAGCCGGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110507238 Original CRISPR AATCTACCCCAGCCGGTGAT GGG Intergenic
No off target data available for this crispr