ID: 1110511973

View in Genome Browser
Species Human (GRCh38)
Location 13:76361423-76361445
Sequence GGGCACACACAGCTGGGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110511959_1110511973 22 Left 1110511959 13:76361378-76361400 CCCCGACCTTGCCAGAAGCATCC No data
Right 1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG No data
1110511961_1110511973 20 Left 1110511961 13:76361380-76361402 CCGACCTTGCCAGAAGCATCCCT No data
Right 1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG No data
1110511957_1110511973 24 Left 1110511957 13:76361376-76361398 CCCCCCGACCTTGCCAGAAGCAT No data
Right 1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG No data
1110511967_1110511973 0 Left 1110511967 13:76361400-76361422 CCTAGCAACAGAGAGGAGGTAAG No data
Right 1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG No data
1110511963_1110511973 11 Left 1110511963 13:76361389-76361411 CCAGAAGCATCCCTAGCAACAGA No data
Right 1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG No data
1110511960_1110511973 21 Left 1110511960 13:76361379-76361401 CCCGACCTTGCCAGAAGCATCCC No data
Right 1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG No data
1110511962_1110511973 16 Left 1110511962 13:76361384-76361406 CCTTGCCAGAAGCATCCCTAGCA No data
Right 1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG No data
1110511958_1110511973 23 Left 1110511958 13:76361377-76361399 CCCCCGACCTTGCCAGAAGCATC No data
Right 1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG No data
1110511966_1110511973 1 Left 1110511966 13:76361399-76361421 CCCTAGCAACAGAGAGGAGGTAA No data
Right 1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110511973 Original CRISPR GGGCACACACAGCTGGGTCA AGG Intergenic
No off target data available for this crispr