ID: 1110512501

View in Genome Browser
Species Human (GRCh38)
Location 13:76367591-76367613
Sequence CAAAGCAATCTTGAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110512495_1110512501 15 Left 1110512495 13:76367553-76367575 CCTAAAATTCATATAAACTGCAA No data
Right 1110512501 13:76367591-76367613 CAAAGCAATCTTGAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110512501 Original CRISPR CAAAGCAATCTTGAGGAAGA AGG Intergenic
No off target data available for this crispr