ID: 1110515732

View in Genome Browser
Species Human (GRCh38)
Location 13:76410541-76410563
Sequence CAGTGTAGACAGATAGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110515728_1110515732 0 Left 1110515728 13:76410518-76410540 CCAACCTCAGGAAATAGATAGGG No data
Right 1110515732 13:76410541-76410563 CAGTGTAGACAGATAGATGGTGG No data
1110515730_1110515732 -4 Left 1110515730 13:76410522-76410544 CCTCAGGAAATAGATAGGGCAGT No data
Right 1110515732 13:76410541-76410563 CAGTGTAGACAGATAGATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110515732 Original CRISPR CAGTGTAGACAGATAGATGG TGG Intergenic
No off target data available for this crispr