ID: 1110516070

View in Genome Browser
Species Human (GRCh38)
Location 13:76413891-76413913
Sequence TACCGCTGTGCCTCACTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110516068_1110516070 7 Left 1110516068 13:76413861-76413883 CCTATCTCTTTTGACTGCTTTTA No data
Right 1110516070 13:76413891-76413913 TACCGCTGTGCCTCACTAGGTGG No data
1110516067_1110516070 8 Left 1110516067 13:76413860-76413882 CCCTATCTCTTTTGACTGCTTTT No data
Right 1110516070 13:76413891-76413913 TACCGCTGTGCCTCACTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110516070 Original CRISPR TACCGCTGTGCCTCACTAGG TGG Intergenic
No off target data available for this crispr