ID: 1110517340

View in Genome Browser
Species Human (GRCh38)
Location 13:76430028-76430050
Sequence CTCAGACATTTATACAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110517340_1110517342 25 Left 1110517340 13:76430028-76430050 CCAAACTTGTATAAATGTCTGAG No data
Right 1110517342 13:76430076-76430098 AGAAACCATCAGAAGTTGAAGGG No data
1110517340_1110517341 24 Left 1110517340 13:76430028-76430050 CCAAACTTGTATAAATGTCTGAG No data
Right 1110517341 13:76430075-76430097 TAGAAACCATCAGAAGTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110517340 Original CRISPR CTCAGACATTTATACAAGTT TGG (reversed) Intergenic
No off target data available for this crispr