ID: 1110517355

View in Genome Browser
Species Human (GRCh38)
Location 13:76430400-76430422
Sequence GTTCTCAGTGGAACTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110517355_1110517359 4 Left 1110517355 13:76430400-76430422 CCAGTTTTAGTTCCACTGAGAAC No data
Right 1110517359 13:76430427-76430449 TGACTCATTATTAGGTGTTGTGG No data
1110517355_1110517357 -4 Left 1110517355 13:76430400-76430422 CCAGTTTTAGTTCCACTGAGAAC No data
Right 1110517357 13:76430419-76430441 GAACCAAATGACTCATTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110517355 Original CRISPR GTTCTCAGTGGAACTAAAAC TGG (reversed) Intergenic
No off target data available for this crispr