ID: 1110521169

View in Genome Browser
Species Human (GRCh38)
Location 13:76478541-76478563
Sequence AGTTGTTCACACATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110521169_1110521178 24 Left 1110521169 13:76478541-76478563 CCTTTCTCCATGTGTGAACAACT No data
Right 1110521178 13:76478588-76478610 CTCTCTTCTTAAACGGACACTGG No data
1110521169_1110521176 17 Left 1110521169 13:76478541-76478563 CCTTTCTCCATGTGTGAACAACT No data
Right 1110521176 13:76478581-76478603 CCTCATCCTCTCTTCTTAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110521169 Original CRISPR AGTTGTTCACACATGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr