ID: 1110522484

View in Genome Browser
Species Human (GRCh38)
Location 13:76497064-76497086
Sequence GCTTTTAAACTGATGTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110522484_1110522485 -4 Left 1110522484 13:76497064-76497086 CCTTTATACATCAGTTTAAAAGC No data
Right 1110522485 13:76497083-76497105 AAGCACATATCTACTTACAGTGG No data
1110522484_1110522486 -3 Left 1110522484 13:76497064-76497086 CCTTTATACATCAGTTTAAAAGC No data
Right 1110522486 13:76497084-76497106 AGCACATATCTACTTACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110522484 Original CRISPR GCTTTTAAACTGATGTATAA AGG (reversed) Intergenic
No off target data available for this crispr