ID: 1110527041

View in Genome Browser
Species Human (GRCh38)
Location 13:76550352-76550374
Sequence CTTCCATCTATTAATGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110527041_1110527043 23 Left 1110527041 13:76550352-76550374 CCGTGTTCATTAATAGATGGAAG No data
Right 1110527043 13:76550398-76550420 AAATTTATTACAAGACGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110527041 Original CRISPR CTTCCATCTATTAATGAACA CGG (reversed) Intergenic
No off target data available for this crispr