ID: 1110527559

View in Genome Browser
Species Human (GRCh38)
Location 13:76556491-76556513
Sequence CTATAAGCATAGATGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110527559_1110527562 17 Left 1110527559 13:76556491-76556513 CCAAGTTTCATCTATGCTTATAG No data
Right 1110527562 13:76556531-76556553 GTCCTTATTTTATACTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110527559 Original CRISPR CTATAAGCATAGATGAAACT TGG (reversed) Intergenic
No off target data available for this crispr