ID: 1110535079

View in Genome Browser
Species Human (GRCh38)
Location 13:76641940-76641962
Sequence TGGTAGGAAAACAACTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110535074_1110535079 19 Left 1110535074 13:76641898-76641920 CCTTATTGGAAAGGAATTAAGGA No data
Right 1110535079 13:76641940-76641962 TGGTAGGAAAACAACTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110535079 Original CRISPR TGGTAGGAAAACAACTTGAG AGG Intergenic
No off target data available for this crispr